Incidental Mutation 'R7950:Slc4a4'
List |< first << previous [record 43 of 45] next >> last >|
ID656407
Institutional Source Beutler Lab
Gene Symbol Slc4a4
Ensembl Gene ENSMUSG00000060961
Gene Namesolute carrier family 4 (anion exchanger), member 4
SynonymsNBC1, NBC
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7950 (G1)
Quality Score104.013
Status Validated
Chromosome5
Chromosomal Location88886818-89239653 bp(+) (GRCm38)
Type of Mutationsplice site (11886 bp from exon)
DNA Base Change (assembly) A to G at 89058278 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113218] [ENSMUST00000130041] [ENSMUST00000134303] [ENSMUST00000148750] [ENSMUST00000156238]
Predicted Effect probably null
Transcript: ENSMUST00000113218
SMART Domains Protein: ENSMUSP00000108844
Gene: ENSMUSG00000060961

DomainStartEndE-ValueType
low complexity region 40 59 N/A INTRINSIC
low complexity region 76 87 N/A INTRINSIC
Pfam:Band_3_cyto 137 379 1.1e-100 PFAM
low complexity region 408 423 N/A INTRINSIC
Pfam:HCO3_cotransp 426 947 3e-246 PFAM
transmembrane domain 953 975 N/A INTRINSIC
low complexity region 999 1015 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000130041
SMART Domains Protein: ENSMUSP00000118413
Gene: ENSMUSG00000060961

DomainStartEndE-ValueType
Pfam:Band_3_cyto 93 344 1.5e-101 PFAM
low complexity region 373 388 N/A INTRINSIC
Pfam:HCO3_cotransp 391 912 2.7e-246 PFAM
transmembrane domain 918 940 N/A INTRINSIC
low complexity region 964 980 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000134303
SMART Domains Protein: ENSMUSP00000119976
Gene: ENSMUSG00000060961

DomainStartEndE-ValueType
Pfam:Band_3_cyto 93 233 1.4e-36 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000148750
SMART Domains Protein: ENSMUSP00000119325
Gene: ENSMUSG00000060961

DomainStartEndE-ValueType
low complexity region 40 59 N/A INTRINSIC
low complexity region 76 87 N/A INTRINSIC
Pfam:Band_3_cyto 137 388 3.7e-101 PFAM
low complexity region 417 432 N/A INTRINSIC
Pfam:HCO3_cotransp 435 956 7.3e-246 PFAM
transmembrane domain 962 984 N/A INTRINSIC
low complexity region 1008 1024 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000156238
SMART Domains Protein: ENSMUSP00000121744
Gene: ENSMUSG00000060961

DomainStartEndE-ValueType
low complexity region 40 59 N/A INTRINSIC
low complexity region 76 87 N/A INTRINSIC
Pfam:Band_3_cyto 137 388 4.6e-101 PFAM
low complexity region 417 432 N/A INTRINSIC
Pfam:HCO3_cotransp 436 956 4.1e-231 PFAM
transmembrane domain 962 984 N/A INTRINSIC
low complexity region 1008 1024 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium bicarbonate cotransporter (NBC) involved in the regulation of bicarbonate secretion and absorption and intracellular pH. Mutations in this gene are associated with proximal renal tubular acidosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit smaller birth size, growth retardation, postnatal lethality, bowel obstructions, altered blood chemistry, acidosis, spleen defects and defects in ion homeostasis. Heterozygotes have decreased levels of circulating bicarbonate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik C T 10: 77,979,767 T31I probably damaging Het
Adgrf5 G A 17: 43,451,157 V1248M probably damaging Het
Alb T C 5: 90,472,464 S478P probably damaging Het
Arhgap17 A G 7: 123,286,816 S698P probably benign Het
Arhgef5 A G 6: 43,273,925 T537A possibly damaging Het
Arl6 A T 16: 59,618,731 probably null Het
Atp13a4 A T 16: 29,449,917 W540R Het
Birc6 A T 17: 74,593,100 D1091V probably damaging Het
Bnc1 A G 7: 81,973,502 V659A probably benign Het
C130074G19Rik T C 1: 184,874,374 probably null Het
C1ql4 T A 15: 99,084,812 H220L probably benign Het
Cacna1s A G 1: 136,100,625 N1147S probably benign Het
Cc2d2a T C 5: 43,695,296 probably null Het
Ccdc36 T C 9: 108,405,671 T273A probably benign Het
Ccl1 T A 11: 82,179,693 I18L probably benign Het
Ecel1 A T 1: 87,148,269 Y729N probably damaging Het
Epha4 T A 1: 77,507,196 I59F probably damaging Het
Filip1l A G 16: 57,569,711 K221E probably damaging Het
Flnc A G 6: 29,456,382 E2193G possibly damaging Het
Galnt10 C G 11: 57,783,723 P513A probably damaging Het
Gm5624 A G 14: 44,560,733 Y139H Het
Golgb1 A C 16: 36,915,424 I1719L probably benign Het
Hsf1 T C 15: 76,498,193 S255P probably benign Het
Ighv2-2 T C 12: 113,588,294 D108G probably damaging Het
Kbtbd3 C T 9: 4,316,878 Q10* probably null Het
Kcnh2 C T 5: 24,333,036 V110M probably benign Het
Magi3 A C 3: 104,016,689 L1112W probably damaging Het
Malrd1 T A 2: 16,128,068 D1933E unknown Het
Mki67 G A 7: 135,699,724 R1194* probably null Het
Nap1l1 T C 10: 111,492,908 Y233H probably damaging Het
Napsa A G 7: 44,585,334 I298V probably benign Het
Nkx6-1 A T 5: 101,663,599 S212R probably damaging Het
Nlrc4 A T 17: 74,445,615 I591N probably damaging Het
Olfr1468-ps1 T C 19: 13,375,067 I35T possibly damaging Het
Orc2 T C 1: 58,467,668 D503G possibly damaging Het
Osbp T A 19: 11,978,248 S343T probably benign Het
Pcdha6 T G 18: 36,969,426 D557E probably damaging Het
Pdcd11 AGAGGAGGAGGAGGAGGAGGAGGAG AGAGGAGGAGGAGGAGGAGGAG 19: 47,113,437 probably benign Het
Ppdpf A G 2: 181,187,857 Y35C probably benign Het
Scrn2 T A 11: 97,030,929 L75Q probably damaging Het
Scube3 G A 17: 28,171,226 V955I probably benign Het
Slc1a1 T C 19: 28,911,761 V478A probably benign Het
Srrm2 T C 17: 23,808,110 L96P unknown Het
Strn A T 17: 78,670,423 L175Q Het
Other mutations in Slc4a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00827:Slc4a4 APN 5 89179686 missense probably benign 0.01
IGL00976:Slc4a4 APN 5 88954798 missense probably damaging 1.00
IGL01074:Slc4a4 APN 5 89179774 missense probably damaging 1.00
IGL01120:Slc4a4 APN 5 89132379 missense probably damaging 1.00
IGL01284:Slc4a4 APN 5 89129673 missense probably benign 0.22
IGL01375:Slc4a4 APN 5 89179734 missense probably damaging 1.00
IGL01399:Slc4a4 APN 5 89228935 missense probably damaging 1.00
IGL01487:Slc4a4 APN 5 89228856 missense probably benign 0.19
IGL02501:Slc4a4 APN 5 89129649 missense probably benign 0.13
IGL03104:Slc4a4 APN 5 89149372 missense probably damaging 1.00
IGL03157:Slc4a4 APN 5 89156513 missense probably damaging 0.99
IGL03205:Slc4a4 APN 5 89149330 missense probably benign 0.00
IGL03356:Slc4a4 APN 5 89122483 missense probably benign 0.00
IGL03372:Slc4a4 APN 5 89156426 missense probably damaging 1.00
IGL03382:Slc4a4 APN 5 89228836 missense probably damaging 1.00
camera UTSW 5 89132507 missense probably damaging 1.00
pixels UTSW 5 89122403 missense probably damaging 0.99
Shutter UTSW 5 89225948 missense probably damaging 1.00
Tetrapod UTSW 5 89228972 missense probably damaging 1.00
tripod UTSW 5 89149333 missense possibly damaging 0.52
BB008:Slc4a4 UTSW 5 89170781 missense probably benign 0.00
BB018:Slc4a4 UTSW 5 89170781 missense probably benign 0.00
PIT4515001:Slc4a4 UTSW 5 89133253 missense probably damaging 1.00
PIT4544001:Slc4a4 UTSW 5 89038543 missense probably damaging 1.00
R0007:Slc4a4 UTSW 5 89038578 missense probably damaging 1.00
R0052:Slc4a4 UTSW 5 89156336 missense possibly damaging 0.71
R0052:Slc4a4 UTSW 5 89156336 missense possibly damaging 0.71
R0054:Slc4a4 UTSW 5 89156336 missense possibly damaging 0.71
R0055:Slc4a4 UTSW 5 89156336 missense possibly damaging 0.71
R0230:Slc4a4 UTSW 5 89156336 missense possibly damaging 0.71
R0234:Slc4a4 UTSW 5 89156336 missense possibly damaging 0.71
R0234:Slc4a4 UTSW 5 89156336 missense possibly damaging 0.71
R0632:Slc4a4 UTSW 5 89129641 missense probably damaging 1.00
R1199:Slc4a4 UTSW 5 89215794 critical splice donor site probably null
R1597:Slc4a4 UTSW 5 89135728 missense probably benign 0.01
R1783:Slc4a4 UTSW 5 89132414 missense probably damaging 1.00
R1813:Slc4a4 UTSW 5 89046308 missense probably damaging 0.98
R1896:Slc4a4 UTSW 5 89046308 missense probably damaging 0.98
R2000:Slc4a4 UTSW 5 89028347 missense probably damaging 1.00
R2139:Slc4a4 UTSW 5 89046264 missense probably damaging 1.00
R2163:Slc4a4 UTSW 5 89214576 missense probably damaging 1.00
R2513:Slc4a4 UTSW 5 89156398 missense probably benign 0.00
R2873:Slc4a4 UTSW 5 89135764 missense probably damaging 1.00
R2995:Slc4a4 UTSW 5 88934814 missense probably damaging 1.00
R3054:Slc4a4 UTSW 5 89225948 missense probably damaging 1.00
R3055:Slc4a4 UTSW 5 89132507 missense probably damaging 1.00
R3055:Slc4a4 UTSW 5 89225948 missense probably damaging 1.00
R3056:Slc4a4 UTSW 5 89225948 missense probably damaging 1.00
R3617:Slc4a4 UTSW 5 89234804 missense probably benign 0.00
R3856:Slc4a4 UTSW 5 89232839 missense probably benign 0.00
R3863:Slc4a4 UTSW 5 89135648 missense possibly damaging 0.95
R3896:Slc4a4 UTSW 5 89197766 splice site probably benign
R4007:Slc4a4 UTSW 5 89214593 missense probably damaging 1.00
R4616:Slc4a4 UTSW 5 89038561 missense probably damaging 1.00
R4740:Slc4a4 UTSW 5 89225894 missense probably damaging 1.00
R5009:Slc4a4 UTSW 5 89149298 critical splice acceptor site probably null
R5119:Slc4a4 UTSW 5 88954862 missense probably null 0.97
R5228:Slc4a4 UTSW 5 89156525 missense possibly damaging 0.50
R5394:Slc4a4 UTSW 5 89197764 critical splice donor site probably null
R5396:Slc4a4 UTSW 5 89046217 missense probably benign 0.00
R5662:Slc4a4 UTSW 5 89028244 missense probably damaging 0.96
R5664:Slc4a4 UTSW 5 89028244 missense probably damaging 0.96
R6021:Slc4a4 UTSW 5 89040402 intron probably benign
R6088:Slc4a4 UTSW 5 89197704 missense probably benign 0.12
R6337:Slc4a4 UTSW 5 89046372 missense probably benign 0.21
R6416:Slc4a4 UTSW 5 89179729 missense probably benign 0.26
R6452:Slc4a4 UTSW 5 89228980 missense probably benign 0.05
R6524:Slc4a4 UTSW 5 89232764 missense probably benign 0.01
R6566:Slc4a4 UTSW 5 89149333 missense possibly damaging 0.52
R6727:Slc4a4 UTSW 5 89170765 missense probably benign 0.00
R6844:Slc4a4 UTSW 5 89228972 missense probably damaging 1.00
R6970:Slc4a4 UTSW 5 89179831 missense probably damaging 0.98
R7021:Slc4a4 UTSW 5 89040346 splice site probably null
R7180:Slc4a4 UTSW 5 89046236 missense probably damaging 0.97
R7197:Slc4a4 UTSW 5 88934574 intron probably benign
R7246:Slc4a4 UTSW 5 89122403 missense probably damaging 0.99
R7309:Slc4a4 UTSW 5 89170751 missense probably benign
R7412:Slc4a4 UTSW 5 89214647 splice site probably null
R7492:Slc4a4 UTSW 5 89129650 missense possibly damaging 0.92
R7561:Slc4a4 UTSW 5 89199697 missense probably damaging 1.00
R7577:Slc4a4 UTSW 5 89225867 missense probably damaging 0.97
R7609:Slc4a4 UTSW 5 89135686 missense probably damaging 1.00
R7781:Slc4a4 UTSW 5 89228932 missense possibly damaging 0.78
R7931:Slc4a4 UTSW 5 89170781 missense probably benign 0.00
R8078:Slc4a4 UTSW 5 89179707 missense probably benign 0.00
R8313:Slc4a4 UTSW 5 89046263 missense possibly damaging 0.84
R8332:Slc4a4 UTSW 5 89179821 missense probably benign 0.11
R8534:Slc4a4 UTSW 5 89135722 missense probably damaging 1.00
Z1177:Slc4a4 UTSW 5 89132459 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAGGATGACTGGGTTACC -3'
(R):5'- TGCCTCTCTAGCAAAGCTCTG -3'

Sequencing Primer
(F):5'- TTACCTAGTGGAGTGAAGAACATCC -3'
(R):5'- GGCAATAGTTCTCACTTAAGCTC -3'
Posted On2020-11-06