Incidental Mutation 'R7980:Gcc2'
ID656424
Institutional Source Beutler Lab
Gene Symbol Gcc2
Ensembl Gene ENSMUSG00000038039
Gene NameGRIP and coiled-coil domain containing 2
Synonyms2600014C01Rik, 0610043A03Rik, 2210420P05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.379) question?
Stock #R7980 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location58255497-58305599 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 58278752 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057659] [ENSMUST00000160416] [ENSMUST00000162041] [ENSMUST00000162860]
Predicted Effect probably null
Transcript: ENSMUST00000057659
SMART Domains Protein: ENSMUSP00000054033
Gene: ENSMUSG00000038039

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
coiled coil region 33 282 N/A INTRINSIC
internal_repeat_2 353 378 3.94e-5 PROSPERO
internal_repeat_2 382 406 3.94e-5 PROSPERO
coiled coil region 790 882 N/A INTRINSIC
low complexity region 939 964 N/A INTRINSIC
internal_repeat_1 1093 1111 1.93e-5 PROSPERO
low complexity region 1115 1132 N/A INTRINSIC
low complexity region 1179 1190 N/A INTRINSIC
coiled coil region 1441 1470 N/A INTRINSIC
internal_repeat_1 1554 1572 1.93e-5 PROSPERO
Grip 1608 1655 4.37e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000160416
SMART Domains Protein: ENSMUSP00000123873
Gene: ENSMUSG00000038039

DomainStartEndE-ValueType
coiled coil region 37 176 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000162041
SMART Domains Protein: ENSMUSP00000124787
Gene: ENSMUSG00000038039

DomainStartEndE-ValueType
coiled coil region 32 246 N/A INTRINSIC
internal_repeat_2 317 342 3.28e-5 PROSPERO
internal_repeat_2 346 370 3.28e-5 PROSPERO
coiled coil region 754 846 N/A INTRINSIC
low complexity region 903 928 N/A INTRINSIC
internal_repeat_1 1057 1075 1.6e-5 PROSPERO
low complexity region 1079 1096 N/A INTRINSIC
low complexity region 1143 1154 N/A INTRINSIC
coiled coil region 1405 1434 N/A INTRINSIC
internal_repeat_1 1518 1536 1.6e-5 PROSPERO
Grip 1572 1619 4.37e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000162860
SMART Domains Protein: ENSMUSP00000124152
Gene: ENSMUSG00000038039

DomainStartEndE-ValueType
coiled coil region 46 182 N/A INTRINSIC
internal_repeat_2 253 278 4.17e-5 PROSPERO
internal_repeat_2 282 306 4.17e-5 PROSPERO
coiled coil region 690 782 N/A INTRINSIC
low complexity region 839 864 N/A INTRINSIC
internal_repeat_1 993 1011 2.06e-5 PROSPERO
low complexity region 1015 1032 N/A INTRINSIC
low complexity region 1079 1090 N/A INTRINSIC
coiled coil region 1341 1370 N/A INTRINSIC
internal_repeat_1 1450 1468 2.06e-5 PROSPERO
Grip 1504 1551 4.37e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (87/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a peripheral membrane protein localized to the trans-Golgi network. It is sensitive to brefeldin A. This encoded protein contains a GRIP domain which is thought to be used in targeting. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2009]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik A G 4: 88,868,078 L101P unknown Het
5430419D17Rik T A 7: 131,234,777 V400E probably damaging Het
Actn3 G A 19: 4,867,922 P339L probably damaging Het
Adamts12 G A 15: 11,263,337 C595Y probably damaging Het
Agl A T 3: 116,792,181 N99K probably benign Het
Aplp1 A T 7: 30,435,567 M592K probably benign Het
Arhgef11 C T 3: 87,697,990 R251C probably benign Het
Arhgef12 A T 9: 42,971,299 C1416* probably null Het
Asah1 A G 8: 41,354,030 M119T Het
Asxl2 A T 12: 3,496,630 Q471H probably damaging Het
Atp6v1c2 A T 12: 17,321,612 D61E probably damaging Het
Btbd16 C A 7: 130,824,367 P520Q probably damaging Het
Cacnb2 A G 2: 14,604,515 E22G probably benign Het
Catspere2 G T 1: 178,003,044 probably null Het
Cdc25a T A 9: 109,879,881 D124E probably damaging Het
Cdc42se1 A T 3: 95,231,855 probably benign Het
Cfap54 T C 10: 92,982,060 K1265E possibly damaging Het
Chaf1b A G 16: 93,884,527 H11R probably damaging Het
Chil4 T C 3: 106,202,744 K345E probably damaging Het
Cntnap1 A G 11: 101,188,893 I1283V probably benign Het
Dagla C T 19: 10,252,042 C618Y possibly damaging Het
Ddx19b C T 8: 111,011,445 V224M possibly damaging Het
Dohh C T 10: 81,387,892 R260* probably null Het
Dsg3 A T 18: 20,531,360 N472Y probably benign Het
Duox1 T A 2: 122,347,320 N1528K possibly damaging Het
Eml6 A G 11: 29,833,205 Y559H probably damaging Het
Esp4 A G 17: 40,602,301 T20A possibly damaging Het
Fbxw21 T C 9: 109,156,571 probably null Het
Gm9774 T A 3: 92,429,099 K99* probably null Het
Grin3b C T 10: 79,975,725 A715V possibly damaging Het
Gxylt2 A T 6: 100,787,209 probably null Het
Hspa4 A T 11: 53,280,577 S267T probably benign Het
Hspd1 A G 1: 55,078,626 V491A possibly damaging Het
Idua A G 5: 108,680,620 E280G probably benign Het
Ift172 T A 5: 31,260,644 E1267V probably benign Het
Itsn1 T A 16: 91,905,294 V1448E unknown Het
Kat6a A G 8: 22,926,416 M647V possibly damaging Het
Kcnq4 A T 4: 120,711,297 D407E probably benign Het
Kif1b A T 4: 149,269,921 F221I probably damaging Het
Lama2 G T 10: 27,363,613 D315E probably damaging Het
Lrrn4 G A 2: 132,878,176 L235F probably damaging Het
Map2k6 T A 11: 110,499,384 I248N Het
Mgat5 A G 1: 127,479,511 Q638R probably benign Het
Mia2 A G 12: 59,108,865 K455E probably damaging Het
Mrs2 A G 13: 25,020,238 C3R possibly damaging Het
Nprl3 A G 11: 32,237,357 I325T probably damaging Het
Nr1h3 T A 2: 91,190,884 Q186L probably benign Het
Oas1f A G 5: 120,851,475 E159G probably benign Het
Olfr1024 A G 2: 85,904,598 F152S probably benign Het
Olfr130 A T 17: 38,067,521 M117L possibly damaging Het
Olfr460 T A 6: 40,572,220 I278N probably benign Het
Olfr591 T A 7: 103,173,035 S201C probably damaging Het
Olfr603 T A 7: 103,383,763 I80F probably damaging Het
Olfr608 T A 7: 103,470,297 F86Y probably damaging Het
Olfr725 T A 14: 50,034,795 S203C probably damaging Het
Olfr967 T C 9: 39,751,121 I245T probably damaging Het
Pbxip1 G C 3: 89,446,341 S267T probably benign Het
Pcdhga10 A T 18: 37,748,592 I469F possibly damaging Het
Pkd1l1 A G 11: 8,854,375 S1739P probably damaging Het
Plcd4 A C 1: 74,565,305 N788T probably benign Het
Pms2 T A 5: 143,931,091 W838R probably damaging Het
Pnpla6 T A 8: 3,536,562 V926D probably damaging Het
Pros1 A T 16: 62,928,153 H663L possibly damaging Het
Prss55 T C 14: 64,078,689 probably null Het
Pum2 T C 12: 8,713,904 Y283H probably damaging Het
Rad21 A G 15: 51,965,026 S549P probably benign Het
Sap130 T A 18: 31,648,129 probably null Het
Sertad4 C T 1: 192,846,881 S209N probably benign Het
Sez6 A G 11: 77,953,842 T164A probably benign Het
Slc22a28 C T 19: 8,101,473 R284Q probably damaging Het
Slco4c1 T C 1: 96,836,925 K474R probably benign Het
Stx5a T C 19: 8,742,438 S56P probably damaging Het
Svopl T C 6: 38,014,809 T379A probably damaging Het
Sypl2 A G 3: 108,217,692 F118L probably damaging Het
Tfrc G A 16: 32,617,149 V215M probably benign Het
Thnsl2 T C 6: 71,138,668 N185S probably damaging Het
Tmem104 T C 11: 115,243,754 I372T probably damaging Het
Tnfaip6 G A 2: 52,051,058 G204S probably damaging Het
Trim12a C T 7: 104,304,128 E259K probably benign Het
Tubgcp6 G A 15: 89,102,029 R1436C probably benign Het
Tyrp1 C T 4: 80,840,627 L246F probably damaging Het
Ubr4 G T 4: 139,418,406 V216F Het
Unc5a A G 13: 54,999,506 I409V possibly damaging Het
Vmn1r15 T C 6: 57,258,414 L89P probably damaging Het
Vmn1r32 A T 6: 66,553,321 L157* probably null Het
Zcchc24 A G 14: 25,719,761 Y160H probably damaging Het
Zfp184 A T 13: 21,960,206 H694L probably damaging Het
Zfp345 A C 2: 150,472,803 Y271* probably null Het
Zranb3 T C 1: 128,102,934 probably benign Het
Other mutations in Gcc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Gcc2 APN 10 58292680 missense probably damaging 1.00
IGL00850:Gcc2 APN 10 58258248 missense probably benign 0.00
IGL00935:Gcc2 APN 10 58278779 splice site probably benign
IGL01551:Gcc2 APN 10 58298869 splice site probably benign
IGL01642:Gcc2 APN 10 58280612 missense probably benign 0.00
IGL02041:Gcc2 APN 10 58269281 missense probably damaging 1.00
IGL02215:Gcc2 APN 10 58271636 missense probably benign 0.36
IGL02448:Gcc2 APN 10 58292571 nonsense probably null
IGL02698:Gcc2 APN 10 58271290 missense possibly damaging 0.76
IGL02888:Gcc2 APN 10 58294828 missense probably damaging 1.00
IGL02936:Gcc2 APN 10 58296140 missense probably damaging 1.00
IGL03223:Gcc2 APN 10 58298734 missense probably damaging 1.00
IGL03249:Gcc2 APN 10 58270992 nonsense probably null
R0179:Gcc2 UTSW 10 58276650 missense probably benign 0.39
R0528:Gcc2 UTSW 10 58298689 missense probably damaging 1.00
R1569:Gcc2 UTSW 10 58270171 missense probably benign 0.00
R1606:Gcc2 UTSW 10 58269448 missense probably damaging 1.00
R1725:Gcc2 UTSW 10 58304115 missense possibly damaging 0.95
R1916:Gcc2 UTSW 10 58276663 missense probably damaging 1.00
R1956:Gcc2 UTSW 10 58286143 missense possibly damaging 0.66
R2058:Gcc2 UTSW 10 58285957 missense probably benign 0.10
R2114:Gcc2 UTSW 10 58269540 nonsense probably null
R2280:Gcc2 UTSW 10 58269680 missense probably benign 0.38
R2435:Gcc2 UTSW 10 58294780 missense probably damaging 1.00
R2876:Gcc2 UTSW 10 58290302 missense probably damaging 0.99
R4753:Gcc2 UTSW 10 58290382 missense probably benign 0.20
R4827:Gcc2 UTSW 10 58286131 critical splice acceptor site probably null
R4911:Gcc2 UTSW 10 58270439 missense probably damaging 1.00
R5033:Gcc2 UTSW 10 58278806 missense probably damaging 0.98
R5224:Gcc2 UTSW 10 58286160 missense probably damaging 1.00
R5271:Gcc2 UTSW 10 58269695 missense possibly damaging 0.46
R5398:Gcc2 UTSW 10 58269507 missense probably benign 0.00
R5411:Gcc2 UTSW 10 58270969 missense probably damaging 0.99
R5594:Gcc2 UTSW 10 58287242 missense probably damaging 0.99
R5825:Gcc2 UTSW 10 58294821 missense probably damaging 1.00
R5974:Gcc2 UTSW 10 58258243 missense probably damaging 0.99
R5987:Gcc2 UTSW 10 58255847 utr 5 prime probably benign
R6195:Gcc2 UTSW 10 58270984 missense probably damaging 0.96
R6198:Gcc2 UTSW 10 58292590 missense probably benign 0.26
R6233:Gcc2 UTSW 10 58270984 missense probably damaging 0.96
R6331:Gcc2 UTSW 10 58271465 missense probably benign
R6349:Gcc2 UTSW 10 58269474 missense probably benign 0.01
R6593:Gcc2 UTSW 10 58271507 missense probably damaging 1.00
R6632:Gcc2 UTSW 10 58270049 splice site probably null
R6647:Gcc2 UTSW 10 58287281 critical splice donor site probably null
R6774:Gcc2 UTSW 10 58281439 missense possibly damaging 0.94
R6808:Gcc2 UTSW 10 58258242 missense probably damaging 0.99
R7072:Gcc2 UTSW 10 58270927 missense probably benign 0.02
R7220:Gcc2 UTSW 10 58280594 missense probably benign 0.00
R7352:Gcc2 UTSW 10 58280698 critical splice donor site probably null
R7384:Gcc2 UTSW 10 58269964 missense probably damaging 1.00
R7439:Gcc2 UTSW 10 58256901 missense probably benign 0.08
R7441:Gcc2 UTSW 10 58256901 missense probably benign 0.08
R7543:Gcc2 UTSW 10 58271264 missense probably benign 0.02
R7843:Gcc2 UTSW 10 58268021 missense possibly damaging 0.77
R7850:Gcc2 UTSW 10 58278881 missense probably damaging 0.96
R8336:Gcc2 UTSW 10 58272367 missense probably damaging 0.99
X0018:Gcc2 UTSW 10 58278814 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCAAGTGTCTGGTACTTTCTAGGAG -3'
(R):5'- TGTAAGGAAACTGGTCTCTGGG -3'

Sequencing Primer
(F):5'- GTCTGGTACTTTCTAGGAGATTCTC -3'
(R):5'- AAACTGGTCTCTGGGTTGTTCTTAC -3'
Posted On2020-11-11