Incidental Mutation 'R7974:Stxbp5'
ID656434
Institutional Source Beutler Lab
Gene Symbol Stxbp5
Ensembl Gene ENSMUSG00000019790
Gene Namesyntaxin binding protein 5 (tomosyn)
Synonyms4930565N16Rik, 0710001E20Rik, LGL3, tomosyn 1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7974 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location9755547-9901079 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to C at 9770695 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038213] [ENSMUST00000125200] [ENSMUST00000136324] [ENSMUST00000141722]
Predicted Effect probably null
Transcript: ENSMUST00000038213
SMART Domains Protein: ENSMUSP00000044535
Gene: ENSMUSG00000019790

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
WD40 46 86 2.21e1 SMART
WD40 88 127 5.94e0 SMART
WD40 132 171 1.97e2 SMART
WD40 185 225 1.99e0 SMART
WD40 228 266 5.69e-4 SMART
Pfam:LLGL 276 385 2e-36 PFAM
WD40 386 465 2.88e-1 SMART
WD40 491 530 3.68e1 SMART
low complexity region 572 591 N/A INTRINSIC
low complexity region 713 724 N/A INTRINSIC
Pfam:Lgl_C 771 1050 2.7e-8 PFAM
PDB:1URQ|A 1086 1145 2e-33 PDB
Predicted Effect probably null
Transcript: ENSMUST00000125200
SMART Domains Protein: ENSMUSP00000121507
Gene: ENSMUSG00000019790

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
WD40 46 86 2.21e1 SMART
WD40 88 127 5.94e0 SMART
WD40 132 171 1.97e2 SMART
WD40 185 225 1.99e0 SMART
WD40 228 266 5.69e-4 SMART
Pfam:LLGL 273 385 1.6e-46 PFAM
WD40 386 465 2.88e-1 SMART
WD40 491 530 3.68e1 SMART
low complexity region 572 591 N/A INTRINSIC
low complexity region 722 730 N/A INTRINSIC
Pfam:Lgl_C 839 994 1.9e-8 PFAM
PDB:1URQ|A 1033 1092 2e-33 PDB
Predicted Effect probably null
Transcript: ENSMUST00000136324
SMART Domains Protein: ENSMUSP00000123355
Gene: ENSMUSG00000019790

DomainStartEndE-ValueType
low complexity region 98 106 N/A INTRINSIC
low complexity region 209 230 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000141722
SMART Domains Protein: ENSMUSP00000123253
Gene: ENSMUSG00000019790

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
WD40 46 86 2.21e1 SMART
WD40 88 127 5.94e0 SMART
WD40 132 171 1.97e2 SMART
WD40 185 225 1.99e0 SMART
WD40 228 266 5.69e-4 SMART
Pfam:LLGL 273 385 1.7e-46 PFAM
WD40 386 465 2.88e-1 SMART
WD40 491 530 3.68e1 SMART
low complexity region 572 591 N/A INTRINSIC
low complexity region 739 747 N/A INTRINSIC
Pfam:Lgl_C 856 1011 2e-8 PFAM
PDB:1URQ|A 1050 1109 2e-33 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Syntaxin 1 is a component of the 7S and 20S SNARE complexes which are involved in docking and fusion of synaptic vesicles with the presynaptic plasma membrane. This gene encodes a syntaxin 1 binding protein. In rat, a similar protein dissociates syntaxin 1 from the Munc18/n-Sec1/rbSec1 complex to form a 10S complex, an intermediate which can be converted to the 7S SNARE complex. Thus this protein is thought to be involved in neurotransmitter release by stimulating SNARE complex formation. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some background sensitive prenatal lethality and increased synaptic transmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 C T 19: 57,044,973 probably null Het
Adamts19 A T 18: 59,011,022 Q892L possibly damaging Het
Adamts9 A G 6: 92,909,687 probably null Het
Aftph T C 11: 20,698,233 *686W probably null Het
AI661453 T C 17: 47,466,081 L244P unknown Het
Ankar C A 1: 72,698,979 E15* probably null Het
Ankrd39 A G 1: 36,546,918 probably benign Het
Arsi A G 18: 60,912,406 D56G probably damaging Het
Blmh T C 11: 76,965,903 I245T possibly damaging Het
Ccr6 T C 17: 8,256,224 F87S probably damaging Het
Cdc42ep2 T C 19: 5,918,495 K61E probably damaging Het
Celsr1 C T 15: 86,031,030 G914D probably damaging Het
Cep126 T A 9: 8,120,763 K86N probably benign Het
Cfap70 A T 14: 20,420,750 F532I probably damaging Het
Cpsf3 T A 12: 21,308,005 L506Q probably damaging Het
Dct A C 14: 118,039,655 I273S probably damaging Het
Dsel T C 1: 111,860,499 I769V probably benign Het
Dus2 G A 8: 106,036,020 E138K probably benign Het
Emsy A G 7: 98,630,218 S305P possibly damaging Het
Erp27 A T 6: 136,908,065 V245D probably damaging Het
Fez1 C A 9: 36,843,948 T81K probably damaging Het
Gli3 A C 13: 15,726,256 Q1409H probably benign Het
Gm10696 T C 3: 94,175,541 K321R probably benign Het
Hdac9 T C 12: 34,303,220 S664G possibly damaging Het
Hibadh A G 6: 52,557,895 S167P probably benign Het
Hsdl1 A G 8: 119,566,333 V121A probably benign Het
Ighv1-18 A C 12: 114,683,049 I6S possibly damaging Het
Iqcm T A 8: 75,554,892 M1K probably null Het
Itch T C 2: 155,192,159 F417S probably damaging Het
Itpr1 C T 6: 108,523,405 T2653I possibly damaging Het
Kank1 T G 19: 25,424,220 Y1064D probably damaging Het
Kmt2c T C 5: 25,300,563 Q3249R probably damaging Het
Lefty1 T C 1: 180,937,820 C318R probably damaging Het
Lmbr1l C T 15: 98,911,619 V147I probably benign Het
Meig1 C A 2: 3,411,874 E37* probably null Het
Mpp3 A G 11: 102,008,354 probably null Het
Muc3 T C 5: 137,146,816 N2S Het
Mup7 T C 4: 60,067,518 E199G possibly damaging Het
Nol4 G C 18: 22,719,025 Y275* probably null Het
Nrxn1 G A 17: 90,700,779 P429S probably damaging Het
Olfr761 T C 17: 37,952,781 Y81C probably damaging Het
Pfkl A T 10: 77,994,162 F367L probably damaging Het
Pik3cg T C 12: 32,204,032 E652G probably benign Het
Prkag3 A G 1: 74,744,821 I301T probably benign Het
Rcn1 G A 2: 105,393,710 P163L probably benign Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc37a2 A T 9: 37,239,125 probably null Het
Slc9b1 C T 3: 135,394,030 T437I possibly damaging Het
Smap1 T G 1: 23,849,441 T248P probably benign Het
Smpd3 A C 8: 106,255,622 C617G probably benign Het
Spata20 T C 11: 94,484,140 N212S possibly damaging Het
Sphkap A C 1: 83,278,962 C355W probably damaging Het
Spsb1 T A 4: 149,907,109 M1L probably damaging Het
Srebf2 C T 15: 82,178,765 R468C probably damaging Het
Taar5 G C 10: 23,971,222 D173H possibly damaging Het
Tfrc A G 16: 32,621,283 D438G probably null Het
Tinag A T 9: 76,999,849 I368K probably benign Het
Tm9sf1 A G 14: 55,636,449 W531R probably damaging Het
Tnc G T 4: 64,000,724 P1154Q possibly damaging Het
Toporsl A G 4: 52,611,645 R513G probably damaging Het
Ttc30a1 T C 2: 75,980,344 H465R probably damaging Het
Vat1 A G 11: 101,466,130 S2P probably benign Het
Vmn2r107 C G 17: 20,357,008 P423A probably benign Het
Vmn2r2 T A 3: 64,117,387 E591V probably damaging Het
Vmn2r62 G A 7: 42,764,607 T804I probably damaging Het
Vmn2r62 T A 7: 42,787,857 Y401F probably damaging Het
Vmn2r89 A T 14: 51,456,002 I270F probably damaging Het
Zfp418 T C 7: 7,182,168 F377L possibly damaging Het
Zkscan5 T C 5: 145,207,692 S182P unknown Het
Other mutations in Stxbp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Stxbp5 APN 10 9799950 missense probably damaging 1.00
IGL00950:Stxbp5 APN 10 9808602 splice site probably benign
IGL01725:Stxbp5 APN 10 9817411 missense probably damaging 1.00
IGL02150:Stxbp5 APN 10 9762821 missense probably damaging 1.00
IGL02339:Stxbp5 APN 10 9816297 missense possibly damaging 0.89
IGL02697:Stxbp5 APN 10 9762956 nonsense probably null
IGL02720:Stxbp5 APN 10 9789361 critical splice donor site probably null
IGL03155:Stxbp5 APN 10 9816290 missense probably null 1.00
IGL03288:Stxbp5 APN 10 9866703 splice site probably null
Fatty_fish UTSW 10 9770551 missense probably damaging 1.00
reindeer UTSW 10 9838092 missense probably damaging 1.00
H8562:Stxbp5 UTSW 10 9769443 missense probably benign 0.36
PIT4544001:Stxbp5 UTSW 10 9817304 critical splice donor site probably null
R0025:Stxbp5 UTSW 10 9762748 missense probably damaging 1.00
R0025:Stxbp5 UTSW 10 9762748 missense probably damaging 1.00
R0219:Stxbp5 UTSW 10 9770528 missense probably benign 0.36
R0226:Stxbp5 UTSW 10 9866698 splice site probably benign
R0631:Stxbp5 UTSW 10 9784358 missense probably benign
R0723:Stxbp5 UTSW 10 9768873 missense probably damaging 1.00
R0833:Stxbp5 UTSW 10 9865099 missense probably damaging 1.00
R0836:Stxbp5 UTSW 10 9865099 missense probably damaging 1.00
R0863:Stxbp5 UTSW 10 9809040 missense possibly damaging 0.86
R1225:Stxbp5 UTSW 10 9812391 missense possibly damaging 0.94
R1271:Stxbp5 UTSW 10 9816269 missense probably damaging 1.00
R1536:Stxbp5 UTSW 10 9838092 missense probably damaging 1.00
R1852:Stxbp5 UTSW 10 9812298 missense possibly damaging 0.94
R1884:Stxbp5 UTSW 10 9812298 missense possibly damaging 0.94
R1902:Stxbp5 UTSW 10 9812298 missense possibly damaging 0.94
R1917:Stxbp5 UTSW 10 9812298 missense possibly damaging 0.94
R1918:Stxbp5 UTSW 10 9812298 missense possibly damaging 0.94
R2174:Stxbp5 UTSW 10 9835846 missense possibly damaging 0.69
R3773:Stxbp5 UTSW 10 9768927 missense probably damaging 1.00
R3901:Stxbp5 UTSW 10 9769419 missense probably damaging 1.00
R3981:Stxbp5 UTSW 10 9789316 intron probably benign
R4572:Stxbp5 UTSW 10 9838144 missense probably damaging 0.99
R4764:Stxbp5 UTSW 10 9770623 missense probably damaging 1.00
R4841:Stxbp5 UTSW 10 9762891 missense probably benign 0.06
R4842:Stxbp5 UTSW 10 9762891 missense probably benign 0.06
R4884:Stxbp5 UTSW 10 9812341 nonsense probably null
R4887:Stxbp5 UTSW 10 9809100 missense probably benign
R4930:Stxbp5 UTSW 10 9760866 utr 3 prime probably benign
R5065:Stxbp5 UTSW 10 9770551 missense probably damaging 1.00
R5285:Stxbp5 UTSW 10 9798275 critical splice acceptor site probably null
R5306:Stxbp5 UTSW 10 9799991 missense probably damaging 1.00
R5455:Stxbp5 UTSW 10 9808508 missense probably benign
R5531:Stxbp5 UTSW 10 9762924 nonsense probably null
R5605:Stxbp5 UTSW 10 9769746 intron probably benign
R5614:Stxbp5 UTSW 10 9760894 utr 3 prime probably benign
R5805:Stxbp5 UTSW 10 9900586 missense probably benign
R5990:Stxbp5 UTSW 10 9835933 missense probably damaging 1.00
R6025:Stxbp5 UTSW 10 9800028 missense probably benign 0.00
R6056:Stxbp5 UTSW 10 9770686 missense probably benign 0.00
R6147:Stxbp5 UTSW 10 9808472 missense possibly damaging 0.93
R6194:Stxbp5 UTSW 10 9817339 missense probably damaging 0.99
R6284:Stxbp5 UTSW 10 9767179 missense probably benign 0.32
R6284:Stxbp5 UTSW 10 9767187 missense probably damaging 1.00
R6394:Stxbp5 UTSW 10 9899231 nonsense probably null
R6427:Stxbp5 UTSW 10 9899254 missense probably damaging 1.00
R6894:Stxbp5 UTSW 10 9784361 missense probably benign 0.00
R7229:Stxbp5 UTSW 10 9798187 missense probably damaging 1.00
R7337:Stxbp5 UTSW 10 9809130 missense possibly damaging 0.93
R7686:Stxbp5 UTSW 10 9769410 missense probably damaging 0.99
R7811:Stxbp5 UTSW 10 9808504 missense probably benign
R8009:Stxbp5 UTSW 10 9816302 missense probably damaging 1.00
R8287:Stxbp5 UTSW 10 9784385 missense probably benign
R8353:Stxbp5 UTSW 10 9809048 missense probably benign 0.30
R8360:Stxbp5 UTSW 10 9812259 critical splice donor site probably null
R8453:Stxbp5 UTSW 10 9809048 missense probably benign 0.30
R8487:Stxbp5 UTSW 10 9812289 missense possibly damaging 0.80
R8548:Stxbp5 UTSW 10 9817306 missense probably null 0.98
R8805:Stxbp5 UTSW 10 9838115 nonsense probably null
X0020:Stxbp5 UTSW 10 9762890 missense possibly damaging 0.47
Z1176:Stxbp5 UTSW 10 9900545 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AGTTCCCACTGTAGTTCCGAC -3'
(R):5'- GAGCTCCATGAAAGCAGTCG -3'

Sequencing Primer
(F):5'- ACTGTAGTTCCGACCCACAGG -3'
(R):5'- CACAGTCAGTGTCTTTAGTAGCTGC -3'
Posted On2020-11-11