Incidental Mutation 'R8246:Gm156'
ID 656440
Institutional Source Beutler Lab
Gene Symbol Gm156
Ensembl Gene ENSMUSG00000071158
Gene Name predicted gene 156
Synonyms LOC232415
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.057) question?
Stock # R8246 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 129766568-129784270 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 129775376 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095409] [ENSMUST00000118532]
AlphaFold Q58A37
Predicted Effect probably benign
Transcript: ENSMUST00000095409
SMART Domains Protein: ENSMUSP00000093058
Gene: ENSMUSG00000071158

DomainStartEndE-ValueType
low complexity region 10 28 N/A INTRINSIC
transmembrane domain 36 58 N/A INTRINSIC
CLECT 100 215 2.91e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118532
SMART Domains Protein: ENSMUSP00000113766
Gene: ENSMUSG00000071158

DomainStartEndE-ValueType
low complexity region 10 28 N/A INTRINSIC
transmembrane domain 36 58 N/A INTRINSIC
CLECT 100 178 1.85e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik T C 5: 9,446,966 V810A probably benign Het
Alpk3 C A 7: 81,092,776 D780E probably benign Het
Anln A C 9: 22,350,955 S947A probably benign Het
Borcs6 C T 11: 69,060,551 P252S probably benign Het
Ccdc109b C A 3: 129,915,165 V328L probably benign Het
Ccdc42 C A 11: 68,587,296 Q28K probably benign Het
Cp A G 3: 19,975,022 I554M probably damaging Het
Dnm3 T G 1: 162,307,917 D429A probably damaging Het
Dok5 A G 2: 170,800,893 K37R probably benign Het
Dtwd2 A T 18: 49,698,425 Y268N probably benign Het
Eif3a T C 19: 60,779,368 E244G probably damaging Het
Fam149a T C 8: 45,381,618 E48G probably benign Het
Fam160a2 T C 7: 105,389,660 E124G probably damaging Het
Fam186a T A 15: 99,940,547 E2605D unknown Het
Fyn T A 10: 39,529,529 W264R probably damaging Het
Gm10024 T A 10: 77,711,535 S27T unknown Het
Gpr157 C T 4: 150,102,296 L294F possibly damaging Het
Kif6 C T 17: 49,758,514 Q506* probably null Het
Loxhd1 A G 18: 77,363,546 K707R possibly damaging Het
Mdn1 C T 4: 32,657,284 P12S probably benign Het
Mrgprb3 T G 7: 48,643,520 L94F probably benign Het
Mycbp2 G T 14: 103,155,204 P3307Q probably damaging Het
Nol8 T G 13: 49,655,248 probably benign Het
Olfr1308 T C 2: 111,960,138 I312V probably benign Het
Olfr744 A G 14: 50,618,384 Y54C probably benign Het
Pax5 T C 4: 44,570,027 H286R probably benign Het
Rmdn2 T A 17: 79,672,537 C381* probably null Het
Rpusd4 A G 9: 35,272,580 I202V probably benign Het
Shank3 A T 15: 89,533,346 R49W possibly damaging Het
Smurf2 T C 11: 106,831,044 T542A probably benign Het
Sorcs2 G A 5: 36,062,588 R371C probably damaging Het
Sqstm1 T C 11: 50,210,561 H66R probably damaging Het
Stard8 C T X: 99,065,964 S155L probably benign Het
Svep1 A T 4: 58,091,889 V1582D probably damaging Het
Tecrl T C 5: 83,279,309 M331V probably damaging Het
Tinf2 T C 14: 55,679,585 S368G probably damaging Het
Tmem184c A T 8: 77,610,185 I14N probably damaging Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Ulk4 T C 9: 121,156,875 *911W probably null Het
Unc13b T C 4: 43,175,954 F2261L unknown Het
Vps16 G C 2: 130,438,873 G241R probably damaging Het
Ythdc1 C T 5: 86,817,322 T292I possibly damaging Het
Other mutations in Gm156
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0844:Gm156 UTSW 6 129775793 missense possibly damaging 0.92
R1498:Gm156 UTSW 6 129771740 missense probably damaging 0.98
R1581:Gm156 UTSW 6 129775833 missense probably benign 0.01
R1866:Gm156 UTSW 6 129775380 critical splice donor site probably null
R1967:Gm156 UTSW 6 129775835 missense possibly damaging 0.83
R2289:Gm156 UTSW 6 129768177 missense probably null 0.04
R2384:Gm156 UTSW 6 129772380 missense probably benign
R5192:Gm156 UTSW 6 129771758 missense probably benign 0.15
R5199:Gm156 UTSW 6 129775818 missense possibly damaging 0.68
R6124:Gm156 UTSW 6 129768135 missense probably benign 0.05
R6290:Gm156 UTSW 6 129766695 missense probably benign 0.01
R7084:Gm156 UTSW 6 129766710 missense possibly damaging 0.51
R7472:Gm156 UTSW 6 129775382 missense probably benign 0.09
R7546:Gm156 UTSW 6 129772380 missense probably benign 0.00
R8077:Gm156 UTSW 6 129766695 missense probably benign 0.01
R8924:Gm156 UTSW 6 129768121 missense probably benign 0.01
R9057:Gm156 UTSW 6 129775840 start codon destroyed probably benign 0.09
R9112:Gm156 UTSW 6 129766734 missense probably benign 0.31
R9713:Gm156 UTSW 6 129775396 missense possibly damaging 0.88
X0026:Gm156 UTSW 6 129768162 missense probably damaging 1.00
Z1088:Gm156 UTSW 6 129772463 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CCCAGTTTAAGAAGCACACTG -3'
(R):5'- GCACAGCTGAAATTATCCAAGAAG -3'

Sequencing Primer
(F):5'- GCACACTGAAATTTTACACATTGAC -3'
(R):5'- GTGTGTGTGCAGAAAACATAATATC -3'
Posted On 2020-11-13