Incidental Mutation 'R8246:Ulk4'
ID 656441
Institutional Source Beutler Lab
Gene Symbol Ulk4
Ensembl Gene ENSMUSG00000040936
Gene Name unc-51-like kinase 4
Synonyms 4932415A06Rik
MMRRC Submission 067852-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.682) question?
Stock # R8246 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 120793520-121115225 bp(-) (GRCm39)
Type of Mutation makesense
DNA Base Change (assembly) T to C at 120985941 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Stop codon to Tryptophan at position 911 (*911W)
Ref Sequence ENSEMBL: ENSMUSP00000129214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051479] [ENSMUST00000051565] [ENSMUST00000170237] [ENSMUST00000171061] [ENSMUST00000171923]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000051479
SMART Domains Protein: ENSMUSP00000057960
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 9.9e-26 PFAM
Pfam:Pkinase 4 280 4.6e-49 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1161 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051565
SMART Domains Protein: ENSMUSP00000054833
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
SCOP:d1jvpp_ 1 32 9e-6 SMART
Blast:S_TKc 4 45 2e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000170237
Predicted Effect probably null
Transcript: ENSMUST00000171061
AA Change: *911W
SMART Domains Protein: ENSMUSP00000129214
Gene: ENSMUSG00000040936
AA Change: *911W

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 4.3e-26 PFAM
Pfam:Pkinase 4 280 2.1e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171923
SMART Domains Protein: ENSMUSP00000131342
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 153 3.1e-14 PFAM
Pfam:Pkinase 4 280 4.9e-50 PFAM
Pfam:Pkinase_Tyr 165 277 6.1e-10 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1171 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the unc-51-like serine/threonine kinase (STK) family. Members of this protein family play a role in neuronal growth and endocytosis. The encoded protein is likely involved in neurite branching, neurite elongation and neuronal migration. Genome-wide association studies (GWAS) indicate an association of variations in this gene with blood pressure and hypertension. Sequence variations in this gene may also be be associated with psychiatric disorders, including schizophrenia and bipolar disorder. Pseudogenes associated with this gene have been identified and are located on chromosome 15. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a null allele show reduced body size, hydrocephaly, dilated brain ventricles, otitis media, and premature death. Hypomorphic mice show partial corpus callosum aplasia, hydrocephaly, subcommissural organ and ependymal motile ciliary defects, aqueduct stenosis, and impaired CSF flow. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk3 C A 7: 80,742,524 (GRCm39) D780E probably benign Het
Anln A C 9: 22,262,251 (GRCm39) S947A probably benign Het
Borcs6 C T 11: 68,951,377 (GRCm39) P252S probably benign Het
Ccdc42 C A 11: 68,478,122 (GRCm39) Q28K probably benign Het
Cp A G 3: 20,029,186 (GRCm39) I554M probably damaging Het
Dnm3 T G 1: 162,135,486 (GRCm39) D429A probably damaging Het
Dok5 A G 2: 170,642,813 (GRCm39) K37R probably benign Het
Dtwd2 A T 18: 49,831,492 (GRCm39) Y268N probably benign Het
Eif3a T C 19: 60,767,806 (GRCm39) E244G probably damaging Het
Elapor2 T C 5: 9,496,966 (GRCm39) V810A probably benign Het
Fam149a T C 8: 45,834,655 (GRCm39) E48G probably benign Het
Fam186a T A 15: 99,838,428 (GRCm39) E2605D unknown Het
Fhip1b T C 7: 105,038,867 (GRCm39) E124G probably damaging Het
Fyn T A 10: 39,405,525 (GRCm39) W264R probably damaging Het
Gm10024 T A 10: 77,547,369 (GRCm39) S27T unknown Het
Gpr157 C T 4: 150,186,753 (GRCm39) L294F possibly damaging Het
Kif6 C T 17: 50,065,542 (GRCm39) Q506* probably null Het
Klrh1 A G 6: 129,752,339 (GRCm39) probably benign Het
Loxhd1 A G 18: 77,451,242 (GRCm39) K707R possibly damaging Het
Mcub C A 3: 129,708,814 (GRCm39) V328L probably benign Het
Mdn1 C T 4: 32,657,284 (GRCm39) P12S probably benign Het
Mrgprb3 T G 7: 48,293,268 (GRCm39) L94F probably benign Het
Mycbp2 G T 14: 103,392,640 (GRCm39) P3307Q probably damaging Het
Nol8 T G 13: 49,808,724 (GRCm39) probably benign Het
Or11g2 A G 14: 50,855,841 (GRCm39) Y54C probably benign Het
Or4f57 T C 2: 111,790,483 (GRCm39) I312V probably benign Het
Pax5 T C 4: 44,570,027 (GRCm39) H286R probably benign Het
Rmdn2 T A 17: 79,979,966 (GRCm39) C381* probably null Het
Rpusd4 A G 9: 35,183,876 (GRCm39) I202V probably benign Het
Shank3 A T 15: 89,417,549 (GRCm39) R49W possibly damaging Het
Smurf2 T C 11: 106,721,870 (GRCm39) T542A probably benign Het
Sorcs2 G A 5: 36,219,932 (GRCm39) R371C probably damaging Het
Sqstm1 T C 11: 50,101,388 (GRCm39) H66R probably damaging Het
Stard8 C T X: 98,109,570 (GRCm39) S155L probably benign Het
Svep1 A T 4: 58,091,889 (GRCm39) V1582D probably damaging Het
Tecrl T C 5: 83,427,156 (GRCm39) M331V probably damaging Het
Tinf2 T C 14: 55,917,042 (GRCm39) S368G probably damaging Het
Tmem184c A T 8: 78,336,814 (GRCm39) I14N probably damaging Het
Ttc28 G A 5: 111,381,207 (GRCm39) D1240N probably benign Het
Unc13b T C 4: 43,175,954 (GRCm39) F2261L unknown Het
Vps16 G C 2: 130,280,793 (GRCm39) G241R probably damaging Het
Ythdc1 C T 5: 86,965,181 (GRCm39) T292I possibly damaging Het
Other mutations in Ulk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Ulk4 APN 9 120,997,358 (GRCm39) missense possibly damaging 0.48
IGL01345:Ulk4 APN 9 121,037,228 (GRCm39) missense possibly damaging 0.48
IGL01432:Ulk4 APN 9 121,095,367 (GRCm39) missense probably damaging 1.00
IGL01807:Ulk4 APN 9 121,084,251 (GRCm39) missense probably damaging 1.00
IGL02139:Ulk4 APN 9 120,970,897 (GRCm39) splice site probably null
IGL02266:Ulk4 APN 9 120,910,766 (GRCm39) missense probably benign 0.10
IGL02511:Ulk4 APN 9 121,017,420 (GRCm39) missense probably damaging 1.00
IGL02546:Ulk4 APN 9 120,981,373 (GRCm39) nonsense probably null
IGL02687:Ulk4 APN 9 121,021,728 (GRCm39) missense possibly damaging 0.89
IGL03220:Ulk4 APN 9 120,974,402 (GRCm39) missense probably damaging 1.00
3-1:Ulk4 UTSW 9 121,084,237 (GRCm39) missense probably benign 0.02
R0031:Ulk4 UTSW 9 121,102,048 (GRCm39) missense probably damaging 1.00
R0433:Ulk4 UTSW 9 120,873,885 (GRCm39) missense probably benign 0.27
R0513:Ulk4 UTSW 9 120,981,391 (GRCm39) missense probably benign 0.13
R0524:Ulk4 UTSW 9 121,081,717 (GRCm39) critical splice donor site probably null
R1268:Ulk4 UTSW 9 121,086,140 (GRCm39) splice site probably benign
R1439:Ulk4 UTSW 9 121,095,324 (GRCm39) missense possibly damaging 0.58
R1470:Ulk4 UTSW 9 120,910,722 (GRCm39) missense probably benign 0.00
R1470:Ulk4 UTSW 9 120,910,722 (GRCm39) missense probably benign 0.00
R1531:Ulk4 UTSW 9 120,873,841 (GRCm39) missense probably damaging 0.97
R1595:Ulk4 UTSW 9 120,873,904 (GRCm39) missense probably damaging 0.96
R1620:Ulk4 UTSW 9 121,033,871 (GRCm39) missense possibly damaging 0.81
R1835:Ulk4 UTSW 9 120,997,250 (GRCm39) missense probably null 1.00
R1966:Ulk4 UTSW 9 121,086,182 (GRCm39) missense probably benign
R2129:Ulk4 UTSW 9 120,981,248 (GRCm39) missense probably benign 0.03
R2329:Ulk4 UTSW 9 121,101,953 (GRCm39) missense probably damaging 1.00
R2877:Ulk4 UTSW 9 121,089,105 (GRCm39) missense probably benign 0.11
R2878:Ulk4 UTSW 9 121,089,105 (GRCm39) missense probably benign 0.11
R3734:Ulk4 UTSW 9 121,091,055 (GRCm39) missense probably benign 0.21
R3769:Ulk4 UTSW 9 121,092,766 (GRCm39) missense probably benign 0.00
R4005:Ulk4 UTSW 9 120,997,265 (GRCm39) missense possibly damaging 0.94
R4024:Ulk4 UTSW 9 120,873,915 (GRCm39) missense possibly damaging 0.86
R4321:Ulk4 UTSW 9 120,903,062 (GRCm39) missense probably benign 0.00
R4461:Ulk4 UTSW 9 120,985,950 (GRCm39) missense possibly damaging 0.83
R4537:Ulk4 UTSW 9 121,092,704 (GRCm39) nonsense probably null
R4542:Ulk4 UTSW 9 121,092,704 (GRCm39) nonsense probably null
R4572:Ulk4 UTSW 9 121,021,830 (GRCm39) missense probably damaging 1.00
R4647:Ulk4 UTSW 9 120,970,918 (GRCm39) missense probably benign 0.15
R4712:Ulk4 UTSW 9 121,073,436 (GRCm39) missense probably benign 0.23
R4730:Ulk4 UTSW 9 121,092,791 (GRCm39) missense probably benign 0.05
R4731:Ulk4 UTSW 9 121,092,704 (GRCm39) nonsense probably null
R4732:Ulk4 UTSW 9 121,092,704 (GRCm39) nonsense probably null
R4733:Ulk4 UTSW 9 121,092,704 (GRCm39) nonsense probably null
R4737:Ulk4 UTSW 9 120,902,938 (GRCm39) nonsense probably null
R4781:Ulk4 UTSW 9 120,932,642 (GRCm39) missense probably benign 0.00
R4860:Ulk4 UTSW 9 121,079,968 (GRCm39) missense possibly damaging 0.68
R4926:Ulk4 UTSW 9 121,087,798 (GRCm39) missense probably benign 0.00
R4990:Ulk4 UTSW 9 121,021,852 (GRCm39) missense probably benign 0.01
R6056:Ulk4 UTSW 9 121,102,021 (GRCm39) missense probably damaging 1.00
R6448:Ulk4 UTSW 9 120,932,696 (GRCm39) missense probably damaging 0.99
R6546:Ulk4 UTSW 9 120,970,960 (GRCm39) missense probably damaging 1.00
R6668:Ulk4 UTSW 9 121,017,408 (GRCm39) missense probably damaging 1.00
R6915:Ulk4 UTSW 9 121,087,886 (GRCm39) missense probably benign
R6929:Ulk4 UTSW 9 120,903,081 (GRCm39) missense probably benign 0.02
R7069:Ulk4 UTSW 9 121,095,583 (GRCm39) missense probably benign 0.25
R7069:Ulk4 UTSW 9 121,087,876 (GRCm39) missense probably benign 0.01
R7293:Ulk4 UTSW 9 121,084,190 (GRCm39) missense probably damaging 1.00
R7299:Ulk4 UTSW 9 120,974,125 (GRCm39) missense probably benign 0.32
R7301:Ulk4 UTSW 9 120,974,125 (GRCm39) missense probably benign 0.32
R7337:Ulk4 UTSW 9 121,077,993 (GRCm39) missense probably benign 0.44
R7395:Ulk4 UTSW 9 121,084,178 (GRCm39) missense probably benign
R7423:Ulk4 UTSW 9 120,932,687 (GRCm39) missense possibly damaging 0.48
R7545:Ulk4 UTSW 9 120,970,904 (GRCm39) missense probably benign 0.00
R7753:Ulk4 UTSW 9 121,095,578 (GRCm39) critical splice donor site probably null
R7790:Ulk4 UTSW 9 121,092,734 (GRCm39) missense possibly damaging 0.70
R7791:Ulk4 UTSW 9 121,092,734 (GRCm39) missense possibly damaging 0.70
R7793:Ulk4 UTSW 9 121,092,734 (GRCm39) missense possibly damaging 0.70
R7834:Ulk4 UTSW 9 121,092,734 (GRCm39) missense possibly damaging 0.70
R7836:Ulk4 UTSW 9 120,873,885 (GRCm39) missense possibly damaging 0.72
R7960:Ulk4 UTSW 9 121,102,022 (GRCm39) missense probably damaging 1.00
R8087:Ulk4 UTSW 9 121,095,317 (GRCm39) missense probably damaging 0.99
R8203:Ulk4 UTSW 9 120,997,274 (GRCm39) missense probably damaging 0.96
R8430:Ulk4 UTSW 9 121,086,144 (GRCm39) critical splice donor site probably null
R8841:Ulk4 UTSW 9 121,033,804 (GRCm39) missense probably damaging 1.00
R9014:Ulk4 UTSW 9 121,017,294 (GRCm39) missense probably benign 0.00
R9092:Ulk4 UTSW 9 120,903,003 (GRCm39) missense
R9126:Ulk4 UTSW 9 121,090,988 (GRCm39) missense probably damaging 0.99
R9176:Ulk4 UTSW 9 120,974,128 (GRCm39) missense probably benign
R9235:Ulk4 UTSW 9 120,981,217 (GRCm39) missense probably benign 0.13
R9713:Ulk4 UTSW 9 120,873,862 (GRCm39) nonsense probably null
X0024:Ulk4 UTSW 9 121,021,819 (GRCm39) missense probably damaging 1.00
X0066:Ulk4 UTSW 9 121,091,672 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTAGCACGGAATTCTCAGC -3'
(R):5'- CATGGCTTTGGAGATCTAATCCG -3'

Sequencing Primer
(F):5'- CCCAACTCCCACCCATGTCTG -3'
(R):5'- GTAGCAGGAGTCATGTGT -3'
Posted On 2020-11-13