Mutagenetix > Incidental Mutation

Incidental Mutation 'R8246:Nol8'

656442

Institutional Source

Beutler Lab

Gene Symbol

Nol8

Ensembl Gene

ENSMUSG00000021392

Gene Name

nucleolar protein 8

Synonyms

5730412B09Rik, D13Ertd548e, 4921532D18Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8246 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

49653078-49679016 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to G at 49655248 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000021824 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021818] [ENSMUST00000021824]

AlphaFold

Q3UHX0

Predicted Effect

probably benign
Transcript: ENSMUST00000021818

SMART Domains

Protein: ENSMUSP00000021818
Gene: ENSMUSG00000021391

Domain	Start	End	E-Value	Type
coiled coil region	1	34	N/A	INTRINSIC
Pfam:CENP-P	102	278	3.9e-89	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000021824

SMART Domains

Protein: ENSMUSP00000021824
Gene: ENSMUSG00000021392

Domain	Start	End	E-Value	Type
RRM	27	103	3.02e-9	SMART
low complexity region	315	327	N/A	INTRINSIC
low complexity region	454	468	N/A	INTRINSIC
low complexity region	712	724	N/A	INTRINSIC
low complexity region	804	816	N/A	INTRINSIC
low complexity region	836	849	N/A	INTRINSIC
coiled coil region	886	916	N/A	INTRINSIC
coiled coil region	955	981	N/A	INTRINSIC
low complexity region	1080	1093	N/A	INTRINSIC
low complexity region	1152	1164	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

100% (43/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NOL8 binds Ras-related GTP-binding proteins (see MIM 608267) and plays a role in cell growth (Sekiguchi et al., 2004 [PubMed 14660641]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330182L06Rik	T	C	5: 9,446,966	V810A	probably benign	Het
Alpk3	C	A	7: 81,092,776	D780E	probably benign	Het
Anln	A	C	9: 22,350,955	S947A	probably benign	Het
Borcs6	C	T	11: 69,060,551	P252S	probably benign	Het
Ccdc109b	C	A	3: 129,915,165	V328L	probably benign	Het
Ccdc42	C	A	11: 68,587,296	Q28K	probably benign	Het
Cp	A	G	3: 19,975,022	I554M	probably damaging	Het
Dnm3	T	G	1: 162,307,917	D429A	probably damaging	Het
Dok5	A	G	2: 170,800,893	K37R	probably benign	Het
Dtwd2	A	T	18: 49,698,425	Y268N	probably benign	Het
Eif3a	T	C	19: 60,779,368	E244G	probably damaging	Het
Fam149a	T	C	8: 45,381,618	E48G	probably benign	Het
Fam160a2	T	C	7: 105,389,660	E124G	probably damaging	Het
Fam186a	T	A	15: 99,940,547	E2605D	unknown	Het
Fyn	T	A	10: 39,529,529	W264R	probably damaging	Het
Gm10024	T	A	10: 77,711,535	S27T	unknown	Het
Gm156	A	G	6: 129,775,376		probably benign	Het
Gpr157	C	T	4: 150,102,296	L294F	possibly damaging	Het
Kif6	C	T	17: 49,758,514	Q506*	probably null	Het
Loxhd1	A	G	18: 77,363,546	K707R	possibly damaging	Het
Mdn1	C	T	4: 32,657,284	P12S	probably benign	Het
Mrgprb3	T	G	7: 48,643,520	L94F	probably benign	Het
Mycbp2	G	T	14: 103,155,204	P3307Q	probably damaging	Het
Olfr1308	T	C	2: 111,960,138	I312V	probably benign	Het
Olfr744	A	G	14: 50,618,384	Y54C	probably benign	Het
Pax5	T	C	4: 44,570,027	H286R	probably benign	Het
Rmdn2	T	A	17: 79,672,537	C381*	probably null	Het
Rpusd4	A	G	9: 35,272,580	I202V	probably benign	Het
Shank3	A	T	15: 89,533,346	R49W	possibly damaging	Het
Smurf2	T	C	11: 106,831,044	T542A	probably benign	Het
Sorcs2	G	A	5: 36,062,588	R371C	probably damaging	Het
Sqstm1	T	C	11: 50,210,561	H66R	probably damaging	Het
Stard8	C	T	X: 99,065,964	S155L	probably benign	Het
Svep1	A	T	4: 58,091,889	V1582D	probably damaging	Het
Tecrl	T	C	5: 83,279,309	M331V	probably damaging	Het
Tinf2	T	C	14: 55,679,585	S368G	probably damaging	Het
Tmem184c	A	T	8: 77,610,185	I14N	probably damaging	Het
Ttc28	G	A	5: 111,233,341	D1240N	probably benign	Het
Ulk4	T	C	9: 121,156,875	*911W	probably null	Het
Unc13b	T	C	4: 43,175,954	F2261L	unknown	Het
Vps16	G	C	2: 130,438,873	G241R	probably damaging	Het
Ythdc1	C	T	5: 86,817,322	T292I	possibly damaging	Het

Other mutations in Nol8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00801:Nol8	APN	13	49662228	missense	probably benign	0.01
IGL01106:Nol8	APN	13	49654481	missense	possibly damaging	0.46
IGL01413:Nol8	APN	13	49659952	missense	possibly damaging	0.82
IGL01540:Nol8	APN	13	49661670	missense	probably benign	0.06
IGL01670:Nol8	APN	13	49661308	missense	possibly damaging	0.54
IGL01672:Nol8	APN	13	49675407	missense	possibly damaging	0.95
IGL02032:Nol8	APN	13	49672772	missense	probably benign
IGL02212:Nol8	APN	13	49662150	missense	possibly damaging	0.87
IGL02323:Nol8	APN	13	49655245	splice site	probably benign
IGL02645:Nol8	APN	13	49665471	critical splice donor site	probably null
IGL02949:Nol8	APN	13	49662402	missense	probably benign	0.01
IGL02954:Nol8	APN	13	49661172	missense	probably benign	0.01
IGL03182:Nol8	APN	13	49664081	missense	probably damaging	1.00
IGL03406:Nol8	APN	13	49661568	missense	probably damaging	1.00
P0047:Nol8	UTSW	13	49654348	splice site	probably null
R0092:Nol8	UTSW	13	49662447	missense	possibly damaging	0.54
R0099:Nol8	UTSW	13	49672689	missense	probably benign
R0145:Nol8	UTSW	13	49662447	missense	possibly damaging	0.54
R0269:Nol8	UTSW	13	49654445	missense	possibly damaging	0.49
R0370:Nol8	UTSW	13	49662447	missense	possibly damaging	0.54
R0374:Nol8	UTSW	13	49662447	missense	possibly damaging	0.54
R0390:Nol8	UTSW	13	49662152	missense	probably damaging	1.00
R0617:Nol8	UTSW	13	49654445	missense	possibly damaging	0.49
R0635:Nol8	UTSW	13	49676758	missense	probably benign	0.05
R0637:Nol8	UTSW	13	49662447	missense	possibly damaging	0.54
R1246:Nol8	UTSW	13	49676769	missense	probably damaging	1.00
R1446:Nol8	UTSW	13	49655227	missense	probably damaging	1.00
R1464:Nol8	UTSW	13	49676788	missense	probably benign
R1464:Nol8	UTSW	13	49676788	missense	probably benign
R1627:Nol8	UTSW	13	49661504	missense	probably benign	0.01
R1703:Nol8	UTSW	13	49667457	missense	possibly damaging	0.65
R1751:Nol8	UTSW	13	49667408	missense	probably benign	0.06
R2187:Nol8	UTSW	13	49661999	missense	probably benign	0.00
R2357:Nol8	UTSW	13	49654504	critical splice donor site	probably null
R3081:Nol8	UTSW	13	49678392	unclassified	probably benign
R3969:Nol8	UTSW	13	49660016	nonsense	probably null
R4199:Nol8	UTSW	13	49661748	missense	possibly damaging	0.65
R4720:Nol8	UTSW	13	49662753	missense	probably damaging	1.00
R4927:Nol8	UTSW	13	49654425	missense	possibly damaging	0.79
R5177:Nol8	UTSW	13	49661112	missense	probably benign	0.32
R5512:Nol8	UTSW	13	49676787	missense	probably benign
R5744:Nol8	UTSW	13	49662326	missense	possibly damaging	0.82
R5988:Nol8	UTSW	13	49672614	missense	possibly damaging	0.58
R6048:Nol8	UTSW	13	49653684	critical splice donor site	probably null
R6306:Nol8	UTSW	13	49676353	missense	probably damaging	1.00
R6359:Nol8	UTSW	13	49664070	missense	probably benign	0.16
R6378:Nol8	UTSW	13	49667355	missense	probably damaging	1.00
R6655:Nol8	UTSW	13	49654392	missense	probably damaging	1.00
R7035:Nol8	UTSW	13	49661202	missense	probably benign	0.06
R7058:Nol8	UTSW	13	49676386	missense	probably damaging	1.00
R7368:Nol8	UTSW	13	49661219	missense	probably benign	0.00
R7450:Nol8	UTSW	13	49660015	missense	probably benign	0.01
R7673:Nol8	UTSW	13	49664780	missense	probably benign	0.15
R7750:Nol8	UTSW	13	49662266	missense	possibly damaging	0.83
R9081:Nol8	UTSW	13	49661405	missense	probably benign	0.00
R9127:Nol8	UTSW	13	49661999	missense	probably benign	0.00
R9223:Nol8	UTSW	13	49661262	missense	possibly damaging	0.63
X0020:Nol8	UTSW	13	49661165	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGGTGTCTGAATTGATTACTTCAGG -3'
(R):5'- GCAAAGTGCCAATGTGTGATAC -3'

Sequencing Primer
(F):5'- ATGTATATTCAGGGCCAGCC -3'
(R):5'- GTGCCAATGTGTGATACCATAC -3'

Posted On

2020-11-13