Incidental Mutation 'R8246:Nol8'
ID 656442
Institutional Source Beutler Lab
Gene Symbol Nol8
Ensembl Gene ENSMUSG00000021392
Gene Name nucleolar protein 8
Synonyms 5730412B09Rik, D13Ertd548e, 4921532D18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8246 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 49653078-49679016 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to G at 49655248 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000021824 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021818] [ENSMUST00000021824]
AlphaFold Q3UHX0
Predicted Effect probably benign
Transcript: ENSMUST00000021818
SMART Domains Protein: ENSMUSP00000021818
Gene: ENSMUSG00000021391

DomainStartEndE-ValueType
coiled coil region 1 34 N/A INTRINSIC
Pfam:CENP-P 102 278 3.9e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000021824
SMART Domains Protein: ENSMUSP00000021824
Gene: ENSMUSG00000021392

DomainStartEndE-ValueType
RRM 27 103 3.02e-9 SMART
low complexity region 315 327 N/A INTRINSIC
low complexity region 454 468 N/A INTRINSIC
low complexity region 712 724 N/A INTRINSIC
low complexity region 804 816 N/A INTRINSIC
low complexity region 836 849 N/A INTRINSIC
coiled coil region 886 916 N/A INTRINSIC
coiled coil region 955 981 N/A INTRINSIC
low complexity region 1080 1093 N/A INTRINSIC
low complexity region 1152 1164 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NOL8 binds Ras-related GTP-binding proteins (see MIM 608267) and plays a role in cell growth (Sekiguchi et al., 2004 [PubMed 14660641]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik T C 5: 9,446,966 V810A probably benign Het
Alpk3 C A 7: 81,092,776 D780E probably benign Het
Anln A C 9: 22,350,955 S947A probably benign Het
Borcs6 C T 11: 69,060,551 P252S probably benign Het
Ccdc109b C A 3: 129,915,165 V328L probably benign Het
Ccdc42 C A 11: 68,587,296 Q28K probably benign Het
Cp A G 3: 19,975,022 I554M probably damaging Het
Dnm3 T G 1: 162,307,917 D429A probably damaging Het
Dok5 A G 2: 170,800,893 K37R probably benign Het
Dtwd2 A T 18: 49,698,425 Y268N probably benign Het
Eif3a T C 19: 60,779,368 E244G probably damaging Het
Fam149a T C 8: 45,381,618 E48G probably benign Het
Fam160a2 T C 7: 105,389,660 E124G probably damaging Het
Fam186a T A 15: 99,940,547 E2605D unknown Het
Fyn T A 10: 39,529,529 W264R probably damaging Het
Gm10024 T A 10: 77,711,535 S27T unknown Het
Gm156 A G 6: 129,775,376 probably benign Het
Gpr157 C T 4: 150,102,296 L294F possibly damaging Het
Kif6 C T 17: 49,758,514 Q506* probably null Het
Loxhd1 A G 18: 77,363,546 K707R possibly damaging Het
Mdn1 C T 4: 32,657,284 P12S probably benign Het
Mrgprb3 T G 7: 48,643,520 L94F probably benign Het
Mycbp2 G T 14: 103,155,204 P3307Q probably damaging Het
Olfr1308 T C 2: 111,960,138 I312V probably benign Het
Olfr744 A G 14: 50,618,384 Y54C probably benign Het
Pax5 T C 4: 44,570,027 H286R probably benign Het
Rmdn2 T A 17: 79,672,537 C381* probably null Het
Rpusd4 A G 9: 35,272,580 I202V probably benign Het
Shank3 A T 15: 89,533,346 R49W possibly damaging Het
Smurf2 T C 11: 106,831,044 T542A probably benign Het
Sorcs2 G A 5: 36,062,588 R371C probably damaging Het
Sqstm1 T C 11: 50,210,561 H66R probably damaging Het
Stard8 C T X: 99,065,964 S155L probably benign Het
Svep1 A T 4: 58,091,889 V1582D probably damaging Het
Tecrl T C 5: 83,279,309 M331V probably damaging Het
Tinf2 T C 14: 55,679,585 S368G probably damaging Het
Tmem184c A T 8: 77,610,185 I14N probably damaging Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Ulk4 T C 9: 121,156,875 *911W probably null Het
Unc13b T C 4: 43,175,954 F2261L unknown Het
Vps16 G C 2: 130,438,873 G241R probably damaging Het
Ythdc1 C T 5: 86,817,322 T292I possibly damaging Het
Other mutations in Nol8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Nol8 APN 13 49662228 missense probably benign 0.01
IGL01106:Nol8 APN 13 49654481 missense possibly damaging 0.46
IGL01413:Nol8 APN 13 49659952 missense possibly damaging 0.82
IGL01540:Nol8 APN 13 49661670 missense probably benign 0.06
IGL01670:Nol8 APN 13 49661308 missense possibly damaging 0.54
IGL01672:Nol8 APN 13 49675407 missense possibly damaging 0.95
IGL02032:Nol8 APN 13 49672772 missense probably benign
IGL02212:Nol8 APN 13 49662150 missense possibly damaging 0.87
IGL02323:Nol8 APN 13 49655245 splice site probably benign
IGL02645:Nol8 APN 13 49665471 critical splice donor site probably null
IGL02949:Nol8 APN 13 49662402 missense probably benign 0.01
IGL02954:Nol8 APN 13 49661172 missense probably benign 0.01
IGL03182:Nol8 APN 13 49664081 missense probably damaging 1.00
IGL03406:Nol8 APN 13 49661568 missense probably damaging 1.00
P0047:Nol8 UTSW 13 49654348 splice site probably null
R0092:Nol8 UTSW 13 49662447 missense possibly damaging 0.54
R0099:Nol8 UTSW 13 49672689 missense probably benign
R0145:Nol8 UTSW 13 49662447 missense possibly damaging 0.54
R0269:Nol8 UTSW 13 49654445 missense possibly damaging 0.49
R0370:Nol8 UTSW 13 49662447 missense possibly damaging 0.54
R0374:Nol8 UTSW 13 49662447 missense possibly damaging 0.54
R0390:Nol8 UTSW 13 49662152 missense probably damaging 1.00
R0617:Nol8 UTSW 13 49654445 missense possibly damaging 0.49
R0635:Nol8 UTSW 13 49676758 missense probably benign 0.05
R0637:Nol8 UTSW 13 49662447 missense possibly damaging 0.54
R1246:Nol8 UTSW 13 49676769 missense probably damaging 1.00
R1446:Nol8 UTSW 13 49655227 missense probably damaging 1.00
R1464:Nol8 UTSW 13 49676788 missense probably benign
R1464:Nol8 UTSW 13 49676788 missense probably benign
R1627:Nol8 UTSW 13 49661504 missense probably benign 0.01
R1703:Nol8 UTSW 13 49667457 missense possibly damaging 0.65
R1751:Nol8 UTSW 13 49667408 missense probably benign 0.06
R2187:Nol8 UTSW 13 49661999 missense probably benign 0.00
R2357:Nol8 UTSW 13 49654504 critical splice donor site probably null
R3081:Nol8 UTSW 13 49678392 unclassified probably benign
R3969:Nol8 UTSW 13 49660016 nonsense probably null
R4199:Nol8 UTSW 13 49661748 missense possibly damaging 0.65
R4720:Nol8 UTSW 13 49662753 missense probably damaging 1.00
R4927:Nol8 UTSW 13 49654425 missense possibly damaging 0.79
R5177:Nol8 UTSW 13 49661112 missense probably benign 0.32
R5512:Nol8 UTSW 13 49676787 missense probably benign
R5744:Nol8 UTSW 13 49662326 missense possibly damaging 0.82
R5988:Nol8 UTSW 13 49672614 missense possibly damaging 0.58
R6048:Nol8 UTSW 13 49653684 critical splice donor site probably null
R6306:Nol8 UTSW 13 49676353 missense probably damaging 1.00
R6359:Nol8 UTSW 13 49664070 missense probably benign 0.16
R6378:Nol8 UTSW 13 49667355 missense probably damaging 1.00
R6655:Nol8 UTSW 13 49654392 missense probably damaging 1.00
R7035:Nol8 UTSW 13 49661202 missense probably benign 0.06
R7058:Nol8 UTSW 13 49676386 missense probably damaging 1.00
R7368:Nol8 UTSW 13 49661219 missense probably benign 0.00
R7450:Nol8 UTSW 13 49660015 missense probably benign 0.01
R7673:Nol8 UTSW 13 49664780 missense probably benign 0.15
R7750:Nol8 UTSW 13 49662266 missense possibly damaging 0.83
R9081:Nol8 UTSW 13 49661405 missense probably benign 0.00
R9127:Nol8 UTSW 13 49661999 missense probably benign 0.00
R9223:Nol8 UTSW 13 49661262 missense possibly damaging 0.63
X0020:Nol8 UTSW 13 49661165 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGTGTCTGAATTGATTACTTCAGG -3'
(R):5'- GCAAAGTGCCAATGTGTGATAC -3'

Sequencing Primer
(F):5'- ATGTATATTCAGGGCCAGCC -3'
(R):5'- GTGCCAATGTGTGATACCATAC -3'
Posted On 2020-11-13