Incidental Mutation 'R8261:Setdb2'
ID 656449
Institutional Source Beutler Lab
Gene Symbol Setdb2
Ensembl Gene ENSMUSG00000071350
Gene Name SET domain, bifurcated 2
Synonyms KMT1F, LOC239122
MMRRC Submission 067686-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.544) question?
Stock # R8261 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 59639458-59678329 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 59651141 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095775] [ENSMUST00000161459]
AlphaFold Q8C267
Predicted Effect probably benign
Transcript: ENSMUST00000095775
SMART Domains Protein: ENSMUSP00000093450
Gene: ENSMUSG00000071350

DomainStartEndE-ValueType
Pfam:MBD 164 236 3.4e-10 PFAM
Pfam:Pre-SET 250 362 1.7e-17 PFAM
SET 370 694 9.33e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161459
SMART Domains Protein: ENSMUSP00000124696
Gene: ENSMUSG00000071350

DomainStartEndE-ValueType
Pfam:MBD 148 220 2.7e-9 PFAM
Pfam:Pre-SET 233 346 1.3e-19 PFAM
SET 354 678 9.33e-32 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that contain a methyl-CpG-binding domain (MBD) and a SET domain and function as histone methyltransferases. This protein is recruited to heterochromatin and plays a role in the regulation of chromosome segregation. This region is commonly deleted in chronic lymphocytic leukemia. Naturally-occuring readthrough transcription occurs from this gene to the downstream PHF11 (PHD finger protein 11) gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit altered response to infection and improved patology following superinfection of influenza virus-infected mice with S. pneumonia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933412E24Rik T C 15: 59,888,425 (GRCm39) E5G probably benign Het
Adam23 T C 1: 63,567,957 (GRCm39) V202A noncoding transcript Het
Adamtsl1 A C 4: 86,195,120 (GRCm39) E512D probably damaging Het
Ahnak A T 19: 8,982,817 (GRCm39) D1367V probably damaging Het
Angpt4 A T 2: 151,769,084 (GRCm39) Q198L probably benign Het
Apcdd1 T A 18: 63,066,974 (GRCm39) H29Q possibly damaging Het
Cdh16 T A 8: 105,341,811 (GRCm39) K755* probably null Het
Cdk6 T G 5: 3,440,685 (GRCm39) F80V probably benign Het
Chd1 T C 17: 17,607,804 (GRCm39) S451P probably benign Het
Chd6 A G 2: 160,799,002 (GRCm39) L2361P probably damaging Het
Chst8 A G 7: 34,447,579 (GRCm39) M13T possibly damaging Het
Cntnap2 T C 6: 47,072,627 (GRCm39) L1065P probably damaging Het
Dctn4 T C 18: 60,659,343 (GRCm39) V14A possibly damaging Het
Dicer1 A T 12: 104,657,865 (GRCm39) V1903D probably damaging Het
E2f2 A G 4: 135,911,791 (GRCm39) silent Het
Eif4g3 T A 4: 137,898,429 (GRCm39) S902T possibly damaging Het
Emid1 G T 11: 5,084,353 (GRCm39) A152D probably benign Het
Fer1l6 T A 15: 58,432,345 (GRCm39) N297K possibly damaging Het
Fes T C 7: 80,032,902 (GRCm39) D281G probably null Het
Frmpd2 T C 14: 33,224,934 (GRCm39) V133A probably benign Het
Fry A G 5: 150,369,372 (GRCm39) Y2282C probably damaging Het
Gm10377 C T 14: 42,616,664 (GRCm39) probably null Het
Gm1527 A G 3: 28,974,749 (GRCm39) T521A probably damaging Het
Gpr141 T A 13: 19,936,013 (GRCm39) H254L probably benign Het
Gpr160 A G 3: 30,950,096 (GRCm39) E56G probably benign Het
Grid2ip T G 5: 143,367,695 (GRCm39) probably null Het
Grin2a A G 16: 9,481,382 (GRCm39) F473S probably damaging Het
Igkv1-131 T C 6: 67,743,102 (GRCm39) T94A probably damaging Het
Inava T A 1: 136,153,215 (GRCm39) N226Y probably damaging Het
Iqgap2 A G 13: 95,772,078 (GRCm39) L1367P probably damaging Het
Kdm5d T A Y: 936,929 (GRCm39) M856K probably damaging Het
Kirrel1 T C 3: 86,995,309 (GRCm39) probably benign Het
Lad1 T C 1: 135,755,500 (GRCm39) S259P probably damaging Het
Lalba A T 15: 98,379,992 (GRCm39) F86Y possibly damaging Het
Lrfn5 G A 12: 61,886,323 (GRCm39) C37Y probably damaging Het
Man2c1 A G 9: 57,046,942 (GRCm39) T665A probably benign Het
Ms4a20 T A 19: 11,087,707 (GRCm39) S75C probably damaging Het
Myh11 T C 16: 14,041,867 (GRCm39) I719V Het
Nbl1 A T 4: 138,812,832 (GRCm39) C34S probably damaging Het
Ncapg T A 5: 45,844,730 (GRCm39) I575N possibly damaging Het
Nlgn1 T C 3: 25,487,816 (GRCm39) T840A possibly damaging Het
Nrdc T C 4: 108,873,876 (GRCm39) S231P possibly damaging Het
Nrg2 T C 18: 36,165,428 (GRCm39) K395E probably benign Het
Nrip1 A T 16: 76,088,949 (GRCm39) N869K possibly damaging Het
Or2a14 T A 6: 43,130,242 (GRCm39) M1K probably null Het
Or4c12 A G 2: 89,773,716 (GRCm39) F248L probably benign Het
Or8s16 A T 15: 98,210,546 (GRCm39) M295K probably benign Het
Otub2 G T 12: 103,369,161 (GRCm39) probably null Het
Paxbp1 T C 16: 90,834,303 (GRCm39) D161G probably benign Het
Pcnx3 C T 19: 5,715,412 (GRCm39) G1946E probably damaging Het
Per2 T A 1: 91,361,170 (GRCm39) Q495L possibly damaging Het
Plxna2 T A 1: 194,431,724 (GRCm39) V571E probably damaging Het
Prr7 C A 13: 55,620,735 (GRCm39) P248T possibly damaging Het
Ptprr A T 10: 116,073,169 (GRCm39) T464S possibly damaging Het
Rapgef2 A G 3: 78,993,325 (GRCm39) V721A probably benign Het
Rfx1 A T 8: 84,819,479 (GRCm39) Y625F probably benign Het
Rps6kb2 G T 19: 4,211,195 (GRCm39) A110D possibly damaging Het
Slc25a31 T C 3: 40,679,351 (GRCm39) I272T probably damaging Het
Smpd1 T C 7: 105,204,520 (GRCm39) V133A probably benign Het
Sorl1 T C 9: 41,925,777 (GRCm39) D1185G probably damaging Het
Spag6 T A 2: 18,750,301 (GRCm39) L449H probably benign Het
Sptb C A 12: 76,668,036 (GRCm39) R687L probably benign Het
Sptbn5 A T 2: 119,877,616 (GRCm39) V1012E noncoding transcript Het
Tmem192 A G 8: 65,416,972 (GRCm39) I188V probably benign Het
Tmem253 G A 14: 52,256,708 (GRCm39) V194M probably benign Het
Tph1 A G 7: 46,303,173 (GRCm39) silent Het
Trak1 A G 9: 121,280,733 (GRCm39) E374G probably damaging Het
Trpv1 A T 11: 73,145,593 (GRCm39) probably null Het
Trub2 T C 2: 29,667,725 (GRCm39) H305R probably benign Het
Ttn A G 2: 76,747,768 (GRCm39) V4427A probably benign Het
Vasn A G 16: 4,466,160 (GRCm39) T36A probably damaging Het
Vmn1r8 A T 6: 57,013,158 (GRCm39) I70F probably benign Het
Vps13c A T 9: 67,862,262 (GRCm39) I2960L probably damaging Het
Zdhhc4 C A 5: 143,307,588 (GRCm39) M144I probably benign Het
Zfp273 T A 13: 67,974,070 (GRCm39) N399K probably benign Het
Zfp976 T A 7: 42,262,125 (GRCm39) T572S unknown Het
Zmym4 A G 4: 126,798,360 (GRCm39) C756R probably damaging Het
Other mutations in Setdb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Setdb2 APN 14 59,653,241 (GRCm39) missense probably damaging 1.00
IGL01695:Setdb2 APN 14 59,639,742 (GRCm39) utr 3 prime probably benign
IGL01720:Setdb2 APN 14 59,660,885 (GRCm39) missense possibly damaging 0.76
IGL02003:Setdb2 APN 14 59,650,939 (GRCm39) missense probably damaging 0.98
IGL02023:Setdb2 APN 14 59,668,607 (GRCm39) missense probably damaging 1.00
IGL02108:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02113:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02114:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02115:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02116:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02117:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02141:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02148:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
R0419:Setdb2 UTSW 14 59,644,193 (GRCm39) splice site probably null
R0610:Setdb2 UTSW 14 59,654,919 (GRCm39) missense possibly damaging 0.55
R0636:Setdb2 UTSW 14 59,644,153 (GRCm39) missense probably benign 0.40
R0890:Setdb2 UTSW 14 59,656,669 (GRCm39) missense possibly damaging 0.89
R0931:Setdb2 UTSW 14 59,660,945 (GRCm39) splice site probably benign
R1355:Setdb2 UTSW 14 59,654,890 (GRCm39) missense probably damaging 1.00
R1553:Setdb2 UTSW 14 59,654,934 (GRCm39) missense probably benign 0.04
R1968:Setdb2 UTSW 14 59,656,858 (GRCm39) missense probably damaging 1.00
R2472:Setdb2 UTSW 14 59,656,903 (GRCm39) missense possibly damaging 0.49
R2894:Setdb2 UTSW 14 59,663,916 (GRCm39) missense probably benign 0.00
R3919:Setdb2 UTSW 14 59,656,616 (GRCm39) missense probably damaging 1.00
R4609:Setdb2 UTSW 14 59,653,153 (GRCm39) missense probably damaging 1.00
R4629:Setdb2 UTSW 14 59,646,808 (GRCm39) missense probably benign 0.13
R4816:Setdb2 UTSW 14 59,651,095 (GRCm39) missense probably benign 0.05
R4864:Setdb2 UTSW 14 59,646,715 (GRCm39) missense probably benign 0.01
R4951:Setdb2 UTSW 14 59,639,752 (GRCm39) missense possibly damaging 0.72
R5040:Setdb2 UTSW 14 59,653,156 (GRCm39) missense probably damaging 0.99
R5245:Setdb2 UTSW 14 59,663,943 (GRCm39) missense probably null 0.00
R5358:Setdb2 UTSW 14 59,646,885 (GRCm39) missense probably benign 0.17
R5656:Setdb2 UTSW 14 59,656,567 (GRCm39) missense probably damaging 1.00
R5705:Setdb2 UTSW 14 59,660,814 (GRCm39) missense possibly damaging 0.80
R6103:Setdb2 UTSW 14 59,646,981 (GRCm39) splice site probably null
R6106:Setdb2 UTSW 14 59,660,898 (GRCm39) nonsense probably null
R6388:Setdb2 UTSW 14 59,662,146 (GRCm39) missense probably benign
R6431:Setdb2 UTSW 14 59,656,505 (GRCm39) missense probably damaging 1.00
R6494:Setdb2 UTSW 14 59,639,863 (GRCm39) missense probably benign 0.12
R6971:Setdb2 UTSW 14 59,653,189 (GRCm39) missense probably damaging 1.00
R7442:Setdb2 UTSW 14 59,656,700 (GRCm39) missense probably damaging 0.99
R7444:Setdb2 UTSW 14 59,660,794 (GRCm39) nonsense probably null
R7759:Setdb2 UTSW 14 59,656,813 (GRCm39) missense probably damaging 1.00
R8021:Setdb2 UTSW 14 59,660,833 (GRCm39) nonsense probably null
R8039:Setdb2 UTSW 14 59,639,824 (GRCm39) missense probably damaging 1.00
R8393:Setdb2 UTSW 14 59,650,180 (GRCm39) missense probably benign 0.04
R8513:Setdb2 UTSW 14 59,639,839 (GRCm39) missense probably damaging 1.00
R8700:Setdb2 UTSW 14 59,654,888 (GRCm39) missense probably damaging 1.00
R8707:Setdb2 UTSW 14 59,660,907 (GRCm39) nonsense probably null
R8940:Setdb2 UTSW 14 59,646,956 (GRCm39) missense probably damaging 1.00
R9217:Setdb2 UTSW 14 59,646,881 (GRCm39) missense possibly damaging 0.61
R9314:Setdb2 UTSW 14 59,650,240 (GRCm39) missense probably benign 0.02
R9336:Setdb2 UTSW 14 59,660,816 (GRCm39) missense unknown
R9442:Setdb2 UTSW 14 59,639,849 (GRCm39) missense probably damaging 1.00
R9525:Setdb2 UTSW 14 59,646,841 (GRCm39) missense probably benign 0.00
R9743:Setdb2 UTSW 14 59,651,002 (GRCm39) missense probably benign 0.00
X0017:Setdb2 UTSW 14 59,656,917 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCACCACTAAGCTTGGGAGG -3'
(R):5'- ATGGACTGGTGCTTCTTTCATATAG -3'

Sequencing Primer
(F):5'- CACTAAGCTTGGGAGGGCAGTC -3'
(R):5'- TTATGAACATAAGACGGCC -3'
Posted On 2020-11-18