Incidental Mutation 'R8217:March5'
ID656451
Institutional Source Beutler Lab
Gene Symbol March5
Ensembl Gene ENSMUSG00000023307
Gene Namemembrane-associated ring finger (C3HC4) 5
Synonyms5730499H23Rik, MITOL, Rnf153, E130202O05Rik, 1810015H18Rik, 2310008I22Rik, MARCH-V, 2700055A20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R8217 (G1)
Quality Score75.0075
Status Validated
Chromosome19
Chromosomal Location37207543-37222139 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 37207811 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024078] [ENSMUST00000079754] [ENSMUST00000112391] [ENSMUST00000126188] [ENSMUST00000126781] [ENSMUST00000131917] [ENSMUST00000132580] [ENSMUST00000136286]
Predicted Effect probably benign
Transcript: ENSMUST00000024078
SMART Domains Protein: ENSMUSP00000024078
Gene: ENSMUSG00000023307

DomainStartEndE-ValueType
RINGv 13 69 3.53e-23 SMART
transmembrane domain 97 119 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 209 228 N/A INTRINSIC
transmembrane domain 238 256 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079754
SMART Domains Protein: ENSMUSP00000078690
Gene: ENSMUSG00000039652

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
low complexity region 54 69 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
low complexity region 168 210 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 273 283 N/A INTRINSIC
low complexity region 410 420 N/A INTRINSIC
RRM 460 532 2.01e-5 SMART
RRM 568 641 1e-2 SMART
PDB:2M13|A 642 707 1e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000112391
SMART Domains Protein: ENSMUSP00000108010
Gene: ENSMUSG00000023307

DomainStartEndE-ValueType
RINGv 13 69 3.53e-23 SMART
transmembrane domain 97 119 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 209 231 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126188
SMART Domains Protein: ENSMUSP00000120416
Gene: ENSMUSG00000039652

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
low complexity region 54 69 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
low complexity region 168 210 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 273 283 N/A INTRINSIC
low complexity region 387 397 N/A INTRINSIC
RRM 437 509 2.01e-5 SMART
RRM 545 618 1e-2 SMART
PDB:2M13|A 619 684 1e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000126781
SMART Domains Protein: ENSMUSP00000122442
Gene: ENSMUSG00000039652

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
low complexity region 54 69 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
low complexity region 168 210 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 273 283 N/A INTRINSIC
low complexity region 387 397 N/A INTRINSIC
RRM 437 509 8.3e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131917
SMART Domains Protein: ENSMUSP00000123080
Gene: ENSMUSG00000039652

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
low complexity region 54 69 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132580
SMART Domains Protein: ENSMUSP00000118723
Gene: ENSMUSG00000039652

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
low complexity region 54 69 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
low complexity region 168 210 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 273 283 N/A INTRINSIC
low complexity region 410 420 N/A INTRINSIC
RRM 460 532 2.01e-5 SMART
RRM 568 641 1e-2 SMART
PDB:2M13|A 642 707 1e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000136286
SMART Domains Protein: ENSMUSP00000116309
Gene: ENSMUSG00000039652

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
low complexity region 54 69 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
low complexity region 168 210 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 273 283 N/A INTRINSIC
RRM 443 515 2.01e-5 SMART
RRM 551 624 1e-2 SMART
PDB:2M13|A 625 690 1e-6 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MARCH5 is a ubiquitin ligase of the mitochondrial outer membrane that plays a role in the control of mitochondrial morphology by regulating mitofusin-2 (MFN2; MIM 608507) and DRP1 (DNM1L; MIM 603850) (Nakamura et al., 2006 [PubMed 16936636]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acrbp T C 6: 125,060,958 L406P probably damaging Het
Aph1b T C 9: 66,779,272 K239E possibly damaging Het
Atp13a4 C A 16: 29,403,801 V1102F Het
B3gat1 G A 9: 26,756,869 A265T probably damaging Het
Bod1l T C 5: 41,831,507 E419G probably damaging Het
Ccdc142 T C 6: 83,103,216 L380P probably damaging Het
Cd55b CTTTT CTTTTT 1: 130,419,600 probably null Het
Cfi A C 3: 129,855,001 N178T possibly damaging Het
Col5a1 T A 2: 27,922,123 D72E unknown Het
Cspg4 T A 9: 56,890,353 V1367D possibly damaging Het
D5Ertd579e A C 5: 36,614,058 S998A probably benign Het
Ehf T C 2: 103,279,631 E77G possibly damaging Het
Erap1 T C 13: 74,672,818 I662T probably benign Het
F11r GGTGTG GGTGTGTG 1: 171,463,088 probably null Het
Klhl8 A G 5: 103,867,600 V486A possibly damaging Het
Lrrc72 A T 12: 36,208,677 D60E probably damaging Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Mtmr12 T C 15: 12,259,640 I365T possibly damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nod2 A C 8: 88,664,157 D364A probably benign Het
Numa1 T A 7: 101,992,669 M108K possibly damaging Het
Nutm2 G T 13: 50,469,723 R152L probably benign Het
Olfr1048 C T 2: 86,236,518 V106M probably benign Het
Olfr299 A G 7: 86,466,182 Y257C probably damaging Het
Olfr325 A T 11: 58,580,966 M41L probably benign Het
Pak1ip1 T A 13: 41,012,650 S350R probably benign Het
Pcdha3 T C 18: 36,946,921 F239L probably damaging Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Pkm C T 9: 59,678,809 T524I possibly damaging Het
Plekhg2 T A 7: 28,368,292 Q245L probably null Het
Pola2 T A 19: 5,963,827 K26N possibly damaging Het
Prune2 G T 19: 17,120,116 A995S probably benign Het
Rap2b C A 3: 61,365,130 T25K possibly damaging Het
Scrib A G 15: 76,067,155 S165P probably damaging Het
Sdk1 A T 5: 142,211,958 H2122L possibly damaging Het
Sec24b A T 3: 130,040,950 F200I possibly damaging Het
Sh3rf1 T C 8: 61,329,930 V226A possibly damaging Het
Sik1 T A 17: 31,851,312 H141L probably damaging Het
Slc9a5 A T 8: 105,363,324 E638V probably damaging Het
Slco1a5 A G 6: 142,275,476 C15R probably benign Het
Slit1 C T 19: 41,624,520 D854N possibly damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tec A T 5: 72,764,259 M372K probably benign Het
Tlr2 A G 3: 83,838,066 F237L probably benign Het
Trio A T 15: 27,818,969 L1597Q probably damaging Het
Trpa1 A T 1: 14,887,023 M723K probably damaging Het
Ttc21a T C 9: 119,954,628 I592T probably benign Het
Vmn2r94 T C 17: 18,243,724 E768G probably damaging Het
Zfhx3 A G 8: 108,950,717 T2800A probably benign Het
Zpld1 A G 16: 55,226,932 probably null Het
Other mutations in March5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00545:March5 APN 19 37217225 missense probably benign 0.00
IGL01537:March5 APN 19 37210668 unclassified probably benign
IGL02142:March5 APN 19 37220493 splice site probably benign
IGL02469:March5 APN 19 37217275 missense probably damaging 1.00
IGL02637:March5 APN 19 37220634 intron probably benign
volatile UTSW 19 37217314 critical splice donor site probably null
R0635:March5 UTSW 19 37220408 missense possibly damaging 0.52
R4573:March5 UTSW 19 37220394 missense probably damaging 0.99
R5073:March5 UTSW 19 37210808 missense possibly damaging 0.95
R6198:March5 UTSW 19 37210741 missense probably damaging 1.00
R6264:March5 UTSW 19 37220741 missense probably damaging 0.99
R7232:March5 UTSW 19 37217314 critical splice donor site probably null
R7716:March5 UTSW 19 37220423 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GCGACTCTTACCTCACAGAG -3'
(R):5'- AAGTCTACGACCCTGACCTC -3'

Sequencing Primer
(F):5'- TCCATGGACCGGAACCCTG -3'
(R):5'- AAACTCAGAGCCCTTTTCCCGG -3'
Posted On2020-11-18