Incidental Mutation 'R8289:Stk11'
ID656455
Institutional Source Beutler Lab
Gene Symbol Stk11
Ensembl Gene ENSMUSG00000003068
Gene Nameserine/threonine kinase 11
SynonymsPar-4, Lkb1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8289 (G1)
Quality Score181.009
Status Validated
Chromosome10
Chromosomal Location80115803-80130682 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to T at 80125906 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003152] [ENSMUST00000105369] [ENSMUST00000105370] [ENSMUST00000105371] [ENSMUST00000144883] [ENSMUST00000147778] [ENSMUST00000152592] [ENSMUST00000169546] [ENSMUST00000170219]
Predicted Effect probably benign
Transcript: ENSMUST00000003152
SMART Domains Protein: ENSMUSP00000003152
Gene: ENSMUSG00000003068

DomainStartEndE-ValueType
S_TKc 49 309 1.28e-80 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105369
SMART Domains Protein: ENSMUSP00000101008
Gene: ENSMUSG00000035640

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
transmembrane domain 41 63 N/A INTRINSIC
low complexity region 185 197 N/A INTRINSIC
low complexity region 269 277 N/A INTRINSIC
low complexity region 380 388 N/A INTRINSIC
low complexity region 402 420 N/A INTRINSIC
low complexity region 444 484 N/A INTRINSIC
low complexity region 515 534 N/A INTRINSIC
low complexity region 559 573 N/A INTRINSIC
low complexity region 627 651 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105370
SMART Domains Protein: ENSMUSP00000101009
Gene: ENSMUSG00000003068

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 180 2.8e-22 PFAM
Pfam:Pkinase 1 183 2.8e-40 PFAM
Pfam:Kinase-like 8 171 5.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105371
Predicted Effect probably benign
Transcript: ENSMUST00000144883
SMART Domains Protein: ENSMUSP00000114195
Gene: ENSMUSG00000003068

DomainStartEndE-ValueType
S_TKc 49 309 1.28e-80 SMART
low complexity region 396 411 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147778
SMART Domains Protein: ENSMUSP00000130389
Gene: ENSMUSG00000035640

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
transmembrane domain 43 65 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152592
SMART Domains Protein: ENSMUSP00000118853
Gene: ENSMUSG00000003068

DomainStartEndE-ValueType
Blast:S_TKc 1 53 6e-31 BLAST
PDB:2WTK|F 1 74 1e-40 PDB
SCOP:d1koba_ 1 89 1e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169546
SMART Domains Protein: ENSMUSP00000132978
Gene: ENSMUSG00000035640

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
transmembrane domain 35 57 N/A INTRINSIC
low complexity region 192 204 N/A INTRINSIC
low complexity region 276 284 N/A INTRINSIC
low complexity region 387 395 N/A INTRINSIC
low complexity region 409 427 N/A INTRINSIC
low complexity region 451 491 N/A INTRINSIC
low complexity region 522 541 N/A INTRINSIC
low complexity region 566 580 N/A INTRINSIC
low complexity region 634 658 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170219
SMART Domains Protein: ENSMUSP00000131487
Gene: ENSMUSG00000035640

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
transmembrane domain 41 63 N/A INTRINSIC
low complexity region 185 197 N/A INTRINSIC
low complexity region 269 277 N/A INTRINSIC
low complexity region 380 388 N/A INTRINSIC
low complexity region 402 420 N/A INTRINSIC
low complexity region 444 484 N/A INTRINSIC
low complexity region 515 534 N/A INTRINSIC
low complexity region 559 573 N/A INTRINSIC
low complexity region 627 651 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: This gene encodes a member of the serine/threonine kinase family. The encoded protein, a known tumor suppressor, activates (via phosphorylation) adenine monophosphate-activated protein kinase (AMPK) and AMPK-related kinase proteins. This upstream regulation of the AMPK pathway is thought to regulate a number of different processes, including cell metabolism, cell polarity, apoptosis and DNA damage response. Mutations in a similar gene in human have been associated with Peutz-Jeghers syndrome. Alternative splicing results in multiple transcript variants, including the S isoform which plays a potential role in spermiogenesis. [provided by RefSeq, Sep 2014]
PHENOTYPE: Targeted heterozygous mutants with one inactivated allele develop benign gastrointestinal polyps. Homozygous null mutant are embryonic lethal. Homozygotes for a hypomorphic allele survive and apparently normal, but male mice are infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a G C 11: 110,036,689 probably benign Het
Adamts3 C A 5: 89,775,423 D175Y possibly damaging Het
Adra1b G A 11: 43,835,488 P201S probably damaging Het
Ahnak2 A G 12: 112,775,808 V610A possibly damaging Het
Ap5s1 A C 2: 131,212,459 H62P probably benign Het
Apeh A G 9: 108,086,245 S593P probably damaging Het
Arhgap24 T C 5: 102,880,826 V289A possibly damaging Het
Atoh1 A G 6: 64,729,909 E196G probably damaging Het
Atp1b3 G A 9: 96,333,549 S271L probably benign Het
Atp6v0a1 A G 11: 101,034,105 R339G probably damaging Het
Calb2 T C 8: 110,168,058 H27R possibly damaging Het
Camkk2 A C 5: 122,756,626 L201R probably damaging Het
Car15 A G 16: 17,836,716 probably null Het
Cecr2 A G 6: 120,758,116 N771S probably benign Het
Cecr6 A T 6: 120,492,761 S332T possibly damaging Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Csmd1 T A 8: 16,058,702 I1896F probably damaging Het
Cubn C T 2: 13,486,802 V145I probably benign Het
Cuedc1 G A 11: 88,182,555 S182N probably benign Het
Cux1 T A 5: 136,308,504 E718V probably damaging Het
Cyp7a1 G A 4: 6,268,295 P477S probably damaging Het
Dcaf17 T A 2: 71,055,374 W16R Het
Dhx8 T A 11: 101,740,745 M388K probably benign Het
Dnah14 T A 1: 181,716,215 Y2453* probably null Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
F830016B08Rik G A 18: 60,300,288 E148K probably benign Het
Gm15800 A G 5: 121,266,361 T434A possibly damaging Het
Gm4955 T C 1: 173,480,466 I655V Het
Ide A G 19: 37,313,553 L368P Het
Ide G C 19: 37,313,554 L368V probably null Het
Insrr A G 3: 87,814,194 M1136V probably damaging Het
Kcne2 A G 16: 92,296,819 E78G probably damaging Het
Lrrc23 A T 6: 124,778,304 L90H probably damaging Het
Magel2 A C 7: 62,379,127 Q593P unknown Het
Mrgpra3 G A 7: 47,589,720 H153Y possibly damaging Het
Msln A G 17: 25,748,906 V595A possibly damaging Het
Mvb12a T C 8: 71,543,059 probably null Het
Myo7a T G 7: 98,077,169 M966L probably benign Het
Ncoa5 C T 2: 165,013,062 D47N possibly damaging Het
Neurl4 T A 11: 69,909,380 probably null Het
Olfr389 T A 11: 73,777,013 M105L probably benign Het
Olfr464 T C 11: 87,914,763 T48A probably benign Het
Olfr501-ps1 T A 7: 108,508,918 H287Q unknown Het
Olfr884 T A 9: 38,047,704 C161S probably benign Het
Osbpl7 T A 11: 97,056,579 S480T probably benign Het
Podnl1 T C 8: 84,131,923 L484P Het
Polr3gl G T 3: 96,581,912 probably benign Het
Prkaa1 G T 15: 5,177,082 V438L possibly damaging Het
Prune2 A T 19: 17,123,009 H1959L probably benign Het
Rad50 A T 11: 53,698,858 L172* probably null Het
Samsn1 C A 16: 75,888,796 G25W probably damaging Het
Sbno1 T G 5: 124,404,005 L362F probably damaging Het
Slc26a6 G A 9: 108,856,031 R43H probably benign Het
Slc35f5 T G 1: 125,562,515 Y49* probably null Het
Slc41a2 T C 10: 83,301,180 I288V probably benign Het
Slc9c1 A G 16: 45,582,981 M804V probably benign Het
Smc6 T A 12: 11,274,051 S66T probably benign Het
Ssh1 T C 5: 113,942,384 D995G probably benign Het
Sycp1 A G 3: 102,841,037 I813T probably benign Het
Treml4 A C 17: 48,274,428 I244L probably benign Het
Unc13b T A 4: 43,172,524 C1117* probably null Het
Wdr35 A G 12: 9,008,020 I526V probably benign Het
Zap70 T C 1: 36,781,137 W500R probably damaging Het
Zfr G T 15: 12,135,271 V49F noncoding transcript Het
Other mutations in Stk11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02695:Stk11 APN 10 80125477 critical splice acceptor site probably null
IGL03055:Stk11 UTSW 10 80128086 missense probably damaging 1.00
R0450:Stk11 UTSW 10 80126086 missense probably damaging 1.00
R0469:Stk11 UTSW 10 80126086 missense probably damaging 1.00
R0501:Stk11 UTSW 10 80126285 missense probably damaging 1.00
R3826:Stk11 UTSW 10 80127948 splice site probably null
R3827:Stk11 UTSW 10 80127948 splice site probably null
R3828:Stk11 UTSW 10 80127948 splice site probably null
R3829:Stk11 UTSW 10 80127948 splice site probably null
R4512:Stk11 UTSW 10 80126377 splice site probably benign
R4515:Stk11 UTSW 10 80116601 unclassified probably benign
R5123:Stk11 UTSW 10 80127941 missense probably damaging 1.00
R5188:Stk11 UTSW 10 80126279 missense probably damaging 1.00
R5341:Stk11 UTSW 10 80126260 missense probably benign 0.13
R5540:Stk11 UTSW 10 80126049 missense probably benign 0.00
R6856:Stk11 UTSW 10 80128090 missense probably benign 0.01
R7213:Stk11 UTSW 10 80116618 start codon destroyed probably null 0.05
R7792:Stk11 UTSW 10 80125437 intron probably benign
R8299:Stk11 UTSW 10 80128033 missense probably benign
Z1177:Stk11 UTSW 10 80128488 missense unknown
Predicted Primers PCR Primer
(F):5'- TTCAGTGCTCCCAGGTTCAG -3'
(R):5'- CCATTGGTGGTGAGTAGCAG -3'

Sequencing Primer
(F):5'- TGCTCCCAGGTTCAGCAGAATC -3'
(R):5'- AACAATGCCCTGGCTGTGTAG -3'
Posted On2020-11-18