Incidental Mutation 'R8305:Clca3a1'
ID 656467
Institutional Source Beutler Lab
Gene Symbol Clca3a1
Ensembl Gene ENSMUSG00000056025
Gene Name chloride channel accessory 3A1
Synonyms Clca1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock # R8305 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 144729677-144760977 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) C to T at 144759166 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000054526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029932] [ENSMUST00000059091]
AlphaFold Q9QX15
Predicted Effect probably benign
Transcript: ENSMUST00000029932
SMART Domains Protein: ENSMUSP00000029932
Gene: ENSMUSG00000056025

DomainStartEndE-ValueType
Pfam:CLCA_N 1 262 5.8e-144 PFAM
VWA 306 473 1.81e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000059091
SMART Domains Protein: ENSMUSP00000054526
Gene: ENSMUSG00000056025

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 306 478 1.44e-23 SMART
Blast:FN3 758 857 2e-44 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C T 14: 63,971,395 E243K possibly damaging Het
Accsl A T 2: 93,866,078 H58Q probably benign Het
Actl7a T A 4: 56,743,744 F90L probably benign Het
Adam5 G A 8: 24,810,703 A270V possibly damaging Het
Angptl3 A G 4: 99,031,311 T103A probably damaging Het
Ankhd1 T C 18: 36,647,166 L1757P possibly damaging Het
Apoa4 T A 9: 46,241,155 M1K probably null Het
Arih1 T A 9: 59,396,487 Q445L probably benign Het
Asb14 A T 14: 26,912,097 I420L probably benign Het
Bbs2 A C 8: 94,074,325 V626G probably damaging Het
BC089597 T A 10: 127,876,995 D287E probably damaging Het
Cep290 C A 10: 100,544,934 A1678D probably benign Het
Cilp G A 9: 65,279,004 G794S probably damaging Het
Clca3b T A 3: 144,825,937 N702I probably damaging Het
Col24a1 T C 3: 145,474,182 V1143A probably benign Het
Cux1 T C 5: 136,360,009 T223A probably benign Het
Defa30 A T 8: 21,135,459 T80S probably benign Het
Dennd1a G A 2: 37,858,081 L375F probably damaging Het
Dnajc6 C T 4: 101,623,787 T675I probably damaging Het
Emc9 A G 14: 55,585,099 V4A probably damaging Het
Enpp3 C G 10: 24,824,929 probably null Het
Fam117b A G 1: 59,913,623 T154A probably benign Het
Filip1 G T 9: 79,820,475 Y287* probably null Het
Flt3 T C 5: 147,348,054 D751G probably damaging Het
Frem1 T A 4: 82,999,989 Q572L probably benign Het
Gja10 G A 4: 32,602,441 probably benign Het
Gm7356 T A 17: 14,001,437 Y110F probably benign Het
Igf2r T C 17: 12,733,860 K233R probably benign Het
Igkv9-129 A T 6: 67,840,222 E103D probably benign Het
Igsf11 C A 16: 39,007,224 T48N probably damaging Het
Itpkc A T 7: 27,214,519 Y506N probably damaging Het
Kat2a A C 11: 100,709,478 M357R possibly damaging Het
Kbtbd12 T C 6: 88,618,150 R233G possibly damaging Het
Kcnd2 T A 6: 21,726,198 C563* probably null Het
Kcnu1 T C 8: 25,891,990 V456A probably benign Het
Kif24 A G 4: 41,428,825 V45A probably damaging Het
Macf1 A T 4: 123,395,621 probably benign Het
Map3k19 T A 1: 127,817,270 E1177D Het
Mdn1 G T 4: 32,725,107 L2575F probably benign Het
Mga T A 2: 119,946,319 M1569K possibly damaging Het
Mvk T C 5: 114,450,779 Y161H probably damaging Het
Olfr119 T A 17: 37,701,498 M276K probably benign Het
Olfr134 C A 17: 38,175,573 T163K probably damaging Het
Olfr301 G T 7: 86,412,779 C139F probably damaging Het
Pcdhb14 T A 18: 37,450,022 V727E possibly damaging Het
Pcsk7 T G 9: 45,910,409 V167G probably damaging Het
Plin5 T C 17: 56,115,221 D146G probably benign Het
Plxna4 C T 6: 32,211,065 G879R possibly damaging Het
Prss58 C T 6: 40,895,660 A171T probably benign Het
Pum1 A G 4: 130,771,920 I1016V probably benign Het
Rbm43 A G 2: 51,926,700 V85A probably damaging Het
RP23-56A14.9 A G 7: 142,135,623 C138R unknown Het
Rptor T A 11: 119,811,986 L393Q probably damaging Het
Sbf2 T G 7: 110,371,618 H857P possibly damaging Het
Scn8a A C 15: 101,040,506 T1919P probably benign Het
Sema6b C T 17: 56,127,084 G377E probably damaging Het
Senp7 T A 16: 56,155,240 D436E probably damaging Het
Slc6a17 T A 3: 107,473,585 I535F probably benign Het
Sptbn2 T A 19: 4,729,130 S281T possibly damaging Het
Stt3b T C 9: 115,254,931 I392M probably damaging Het
Tfap2b T C 1: 19,226,436 V201A possibly damaging Het
Timm10b T C 7: 105,640,669 probably benign Het
Ttc23 A C 7: 67,662,387 D14A probably damaging Het
Usp32 A T 11: 85,032,185 L636I possibly damaging Het
Vgll4 G T 6: 114,890,652 H79Q probably damaging Het
Vps13d A G 4: 145,092,288 I3047T Het
Zan T C 5: 137,450,551 E1680G unknown Het
Other mutations in Clca3a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00768:Clca3a1 APN 3 144755251 missense probably damaging 0.96
IGL01331:Clca3a1 APN 3 144747512 missense probably damaging 1.00
IGL01895:Clca3a1 APN 3 144747572 nonsense probably null
IGL01940:Clca3a1 APN 3 144746976 missense probably benign 0.25
IGL02162:Clca3a1 APN 3 144754803 missense probably damaging 0.98
IGL02200:Clca3a1 APN 3 144751929 splice site probably benign
IGL03093:Clca3a1 APN 3 144747501 missense probably damaging 0.99
Lucha UTSW 3 144749689 missense probably damaging 1.00
R0256:Clca3a1 UTSW 3 144730879 missense probably damaging 0.98
R0513:Clca3a1 UTSW 3 144760562 critical splice donor site probably null
R0543:Clca3a1 UTSW 3 144748394 splice site probably benign
R1522:Clca3a1 UTSW 3 144755171 missense probably benign 0.01
R1744:Clca3a1 UTSW 3 144746835 missense probably damaging 0.99
R1873:Clca3a1 UTSW 3 144746829 missense probably damaging 0.99
R2238:Clca3a1 UTSW 3 144752005 missense possibly damaging 0.94
R2278:Clca3a1 UTSW 3 144758024 missense probably damaging 0.99
R2516:Clca3a1 UTSW 3 144737858 splice site probably null
R3737:Clca3a1 UTSW 3 144730721 missense probably benign 0.01
R3981:Clca3a1 UTSW 3 144755309 missense probably benign 0.00
R3982:Clca3a1 UTSW 3 144755309 missense probably benign 0.00
R3983:Clca3a1 UTSW 3 144755309 missense probably benign 0.00
R4038:Clca3a1 UTSW 3 144755233 missense probably benign 0.35
R4382:Clca3a1 UTSW 3 144760722 start codon destroyed probably benign 0.08
R4543:Clca3a1 UTSW 3 144746988 missense probably damaging 1.00
R4766:Clca3a1 UTSW 3 144749712 missense probably damaging 1.00
R4899:Clca3a1 UTSW 3 144737961 missense probably damaging 1.00
R5090:Clca3a1 UTSW 3 144737872 missense probably benign 0.01
R5091:Clca3a1 UTSW 3 144730722 missense probably benign 0.00
R5205:Clca3a1 UTSW 3 144746784 missense possibly damaging 0.68
R5248:Clca3a1 UTSW 3 144737136 missense possibly damaging 0.62
R5354:Clca3a1 UTSW 3 144737005 missense possibly damaging 0.77
R5871:Clca3a1 UTSW 3 144754881 missense probably damaging 1.00
R5907:Clca3a1 UTSW 3 144749642 intron probably benign
R5976:Clca3a1 UTSW 3 144746875 missense probably damaging 1.00
R6190:Clca3a1 UTSW 3 144758060 missense probably benign 0.40
R6193:Clca3a1 UTSW 3 144759232 missense possibly damaging 0.65
R6263:Clca3a1 UTSW 3 144749778 missense probably damaging 1.00
R6299:Clca3a1 UTSW 3 144758514 missense probably damaging 0.99
R6327:Clca3a1 UTSW 3 144730797 missense probably benign 0.02
R6497:Clca3a1 UTSW 3 144759259 missense possibly damaging 0.81
R6542:Clca3a1 UTSW 3 144759260 missense probably benign 0.01
R6547:Clca3a1 UTSW 3 144736947 missense probably damaging 1.00
R6759:Clca3a1 UTSW 3 144749689 missense probably damaging 1.00
R7032:Clca3a1 UTSW 3 144747568 missense probably benign 0.07
R7063:Clca3a1 UTSW 3 144755206 missense probably damaging 0.97
R7139:Clca3a1 UTSW 3 144755302 missense possibly damaging 0.58
R7638:Clca3a1 UTSW 3 144751962 missense probably damaging 1.00
R7663:Clca3a1 UTSW 3 144737036 missense probably benign 0.02
R7792:Clca3a1 UTSW 3 144749731 missense possibly damaging 0.95
R7798:Clca3a1 UTSW 3 144757962 missense probably damaging 1.00
R7892:Clca3a1 UTSW 3 144730818 missense probably benign 0.00
R8096:Clca3a1 UTSW 3 144749685 missense probably damaging 1.00
R8416:Clca3a1 UTSW 3 144755153 critical splice donor site probably null
R8446:Clca3a1 UTSW 3 144748487 missense probably damaging 0.97
R8496:Clca3a1 UTSW 3 144747421 makesense probably null
R9014:Clca3a1 UTSW 3 144736970 missense probably benign 0.01
R9128:Clca3a1 UTSW 3 144758034 missense probably damaging 1.00
R9601:Clca3a1 UTSW 3 144747549 missense probably benign 0.27
Z1088:Clca3a1 UTSW 3 144746953 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCATGTTTGTGTGCATCTAC -3'
(R):5'- ACGGATCCAAGAGATTCAGTC -3'

Sequencing Primer
(F):5'- TGTGCATCTACACACATACACAAAC -3'
(R):5'- TTGAGATTGCTACCACAATGCAC -3'
Posted On 2020-11-23