Incidental Mutation 'R7975:Ino80'
ID 656470
Institutional Source Beutler Lab
Gene Symbol Ino80
Ensembl Gene ENSMUSG00000034154
Gene Name INO80 complex subunit
Synonyms INO80, 2310079N15Rik, 4632409L19Rik, Inoc1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock # R7975 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 119373042-119477687 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 119456467 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049920] [ENSMUST00000110808]
AlphaFold Q6ZPV2
Predicted Effect probably null
Transcript: ENSMUST00000049920
SMART Domains Protein: ENSMUSP00000051845
Gene: ENSMUSG00000034154

DomainStartEndE-ValueType
coiled coil region 131 165 N/A INTRINSIC
low complexity region 206 242 N/A INTRINSIC
Pfam:DBINO 275 407 6.6e-50 PFAM
low complexity region 474 489 N/A INTRINSIC
DEXDc 516 714 6.27e-37 SMART
low complexity region 907 923 N/A INTRINSIC
HELICc 1134 1217 2.86e-22 SMART
low complexity region 1270 1324 N/A INTRINSIC
low complexity region 1357 1368 N/A INTRINSIC
low complexity region 1424 1436 N/A INTRINSIC
low complexity region 1438 1450 N/A INTRINSIC
low complexity region 1457 1483 N/A INTRINSIC
low complexity region 1510 1521 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110808
SMART Domains Protein: ENSMUSP00000106431
Gene: ENSMUSG00000034154

DomainStartEndE-ValueType
coiled coil region 131 165 N/A INTRINSIC
low complexity region 206 242 N/A INTRINSIC
Pfam:DBINO 272 412 8.8e-55 PFAM
low complexity region 474 489 N/A INTRINSIC
DEXDc 516 714 6.27e-37 SMART
low complexity region 907 923 N/A INTRINSIC
PDB:3MWY|W 1098 1136 6e-7 PDB
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the chromatin remodeling complex, which is classified into subfamilies depending on sequence features apart from the conserved ATPase domain. This protein is the catalytic ATPase subunit of the INO80 chromatin remodeling complex, which is characterized by a DNA-binding domain. This protein is proposed to bind DNA and be recruited by the YY1 transcription factor to activate certain genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Embryos homozygous for a knock-out allele die around E7.5 and show absence of anterior and distal visceral endoderm. Another null allele results in embryonic lethality by E13.5-E14.5 with severe growth retardation and developmental defects. Heterozygotes show defects in hindlimb extension reflex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik C T 10: 82,283,989 A4396T possibly damaging Het
Ano4 T C 10: 89,116,985 I60V possibly damaging Het
Ano5 T A 7: 51,566,538 M381K probably null Het
Aox2 T A 1: 58,309,028 I635K probably benign Het
BC067074 A G 13: 113,319,307 H629R Het
Bdp1 C T 13: 100,020,376 C2436Y probably benign Het
Bod1l T C 5: 41,816,277 R2565G possibly damaging Het
Brd2 A T 17: 34,115,450 I245N probably damaging Het
Capn9 G A 8: 124,598,776 V258M probably damaging Het
Ccar2 C G 14: 70,143,469 C324S possibly damaging Het
Cd209b A T 8: 3,925,948 I71N probably benign Het
Cdk12 A T 11: 98,221,102 I729F unknown Het
Celf1 T G 2: 91,001,078 V84G probably damaging Het
Cgn G T 3: 94,764,529 A965E probably benign Het
Cgnl1 T C 9: 71,725,322 E249G probably benign Het
Cyp2j8 T C 4: 96,470,539 N381S possibly damaging Het
Dmtf1 T C 5: 9,129,169 D343G probably damaging Het
Fhl5 T A 4: 25,214,730 I16F probably benign Het
Gatd1 A G 7: 141,409,868 F143S probably damaging Het
Gbp10 C T 5: 105,221,101 G291R probably benign Het
Gm28168 T C 1: 117,948,090 Y150H probably benign Het
Gm3543 T C 14: 41,980,165 M121V probably benign Het
Gramd3 A G 18: 56,485,379 T220A probably benign Het
Gstcd A G 3: 133,072,102 L316P probably damaging Het
Hspg2 G A 4: 137,555,221 G3424D probably benign Het
Ifi209 C T 1: 173,641,156 S184F probably benign Het
Kcnd3 G A 3: 105,458,994 R60H probably damaging Het
Kif21b T C 1: 136,171,173 C1400R probably damaging Het
Lama3 C T 18: 12,537,739 P794L probably damaging Het
Lgals4 A G 7: 28,840,921 I214V probably benign Het
Lipo4 A T 19: 33,512,628 L158Q probably damaging Het
Ltv1 A G 10: 13,190,709 Y58H probably damaging Het
Mitf T C 6: 98,018,029 S479P probably benign Het
Mthfr A T 4: 148,043,463 D132V probably damaging Het
Mtrr T C 13: 68,579,547 probably null Het
Neb T A 2: 52,160,666 H6660L probably benign Het
Nhlrc3 A T 3: 53,453,545 V263E probably damaging Het
Oas1h G A 5: 120,871,827 V322M probably damaging Het
Olfr1234 C T 2: 89,363,069 R120H probably benign Het
Olfr165 T A 16: 19,407,551 D155V probably damaging Het
Olfr519 A T 7: 108,893,812 Y203* probably null Het
Pappa A T 4: 65,294,468 D1121V probably damaging Het
Pax5 A G 4: 44,537,465 S352P probably damaging Het
Piezo1 C A 8: 122,495,765 R915L Het
R3hcc1 T C 14: 69,707,144 D7G probably damaging Het
Rasgrp2 A G 19: 6,408,559 K429E probably damaging Het
Scn10a A G 9: 119,672,220 F166S probably benign Het
Scn9a T G 2: 66,484,253 N1707T probably damaging Het
Sec23ip T C 7: 128,762,477 F493S probably damaging Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slfn4 A T 11: 83,187,156 I257F possibly damaging Het
Smarcal1 T A 1: 72,612,991 D637E probably benign Het
Smpd3 A C 8: 106,255,622 C617G probably benign Het
Sos2 A T 12: 69,593,040 F990L probably benign Het
Syne1 T C 10: 5,031,786 T844A probably benign Het
Tph1 G A 7: 46,657,254 R145C probably damaging Het
Ubap2l G A 3: 90,038,769 probably null Het
Vmn2r50 T C 7: 10,037,345 I810V probably benign Het
Vmn2r59 T C 7: 42,043,775 D467G probably damaging Het
Zfp618 T A 4: 63,131,115 N417K possibly damaging Het
Other mutations in Ino80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Ino80 APN 2 119456718 missense possibly damaging 0.83
IGL01404:Ino80 APN 2 119456718 missense possibly damaging 0.83
IGL01985:Ino80 APN 2 119433321 missense probably damaging 0.99
IGL02039:Ino80 APN 2 119380073 missense probably damaging 1.00
IGL02187:Ino80 APN 2 119445457 splice site probably benign
IGL02726:Ino80 APN 2 119442483 missense probably damaging 1.00
Chosen UTSW 2 119382269 splice site probably null
PIT4677001:Ino80 UTSW 2 119377545 missense probably benign
R0004:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0004:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0057:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0113:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0114:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0115:Ino80 UTSW 2 119431016 missense probably damaging 1.00
R0138:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0189:Ino80 UTSW 2 119379679 missense probably benign 0.36
R0363:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0364:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0365:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0481:Ino80 UTSW 2 119431016 missense probably damaging 1.00
R0532:Ino80 UTSW 2 119381983 missense possibly damaging 0.79
R0580:Ino80 UTSW 2 119383481 missense probably damaging 1.00
R0610:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0675:Ino80 UTSW 2 119383481 missense probably damaging 1.00
R1275:Ino80 UTSW 2 119427055 missense probably benign 0.12
R1470:Ino80 UTSW 2 119379649 missense probably damaging 1.00
R1470:Ino80 UTSW 2 119379649 missense probably damaging 1.00
R1506:Ino80 UTSW 2 119425265 nonsense probably null
R1510:Ino80 UTSW 2 119450049 missense probably damaging 1.00
R1570:Ino80 UTSW 2 119447028 missense possibly damaging 0.68
R1613:Ino80 UTSW 2 119392867 missense probably damaging 1.00
R1673:Ino80 UTSW 2 119381936 missense probably damaging 1.00
R1773:Ino80 UTSW 2 119418409 missense probably benign 0.18
R1795:Ino80 UTSW 2 119406859 missense probably damaging 1.00
R2093:Ino80 UTSW 2 119426670 missense possibly damaging 0.55
R2105:Ino80 UTSW 2 119431929 missense probably null 1.00
R2113:Ino80 UTSW 2 119454084 missense probably damaging 1.00
R3618:Ino80 UTSW 2 119446872 missense probably null 0.81
R4572:Ino80 UTSW 2 119402358 missense probably damaging 1.00
R4649:Ino80 UTSW 2 119431008 missense probably damaging 1.00
R4919:Ino80 UTSW 2 119442592 missense probably damaging 1.00
R5113:Ino80 UTSW 2 119431945 missense probably damaging 1.00
R5138:Ino80 UTSW 2 119383421 missense probably damaging 1.00
R5458:Ino80 UTSW 2 119412429 missense possibly damaging 0.50
R5499:Ino80 UTSW 2 119441647 missense probably damaging 1.00
R5502:Ino80 UTSW 2 119402396 missense probably damaging 1.00
R5531:Ino80 UTSW 2 119445575 missense probably benign
R5740:Ino80 UTSW 2 119431029 missense probably damaging 1.00
R5892:Ino80 UTSW 2 119439547 intron probably benign
R5914:Ino80 UTSW 2 119458216 missense probably damaging 0.99
R6000:Ino80 UTSW 2 119374508 missense probably benign 0.04
R6263:Ino80 UTSW 2 119383414 missense probably damaging 1.00
R6505:Ino80 UTSW 2 119451441 missense probably damaging 1.00
R6942:Ino80 UTSW 2 119383502 missense probably damaging 0.99
R7052:Ino80 UTSW 2 119426587 critical splice donor site probably null
R7100:Ino80 UTSW 2 119374513 missense possibly damaging 0.47
R7163:Ino80 UTSW 2 119392875 missense probably damaging 1.00
R7187:Ino80 UTSW 2 119426591 missense probably benign 0.00
R7202:Ino80 UTSW 2 119374437 missense probably benign 0.00
R7218:Ino80 UTSW 2 119458127 missense probably benign
R7389:Ino80 UTSW 2 119442529 missense probably benign 0.00
R7419:Ino80 UTSW 2 119380014 missense probably benign 0.00
R7437:Ino80 UTSW 2 119442586 missense possibly damaging 0.86
R7607:Ino80 UTSW 2 119382269 splice site probably null
R7702:Ino80 UTSW 2 119442573 missense probably benign 0.01
R7978:Ino80 UTSW 2 119439393 missense possibly damaging 0.93
R8376:Ino80 UTSW 2 119442487 missense probably benign 0.14
R8469:Ino80 UTSW 2 119379593 missense probably benign
R8720:Ino80 UTSW 2 119402387 missense probably damaging 1.00
R8751:Ino80 UTSW 2 119406908 missense probably benign
R8958:Ino80 UTSW 2 119383381 missense probably damaging 1.00
R8992:Ino80 UTSW 2 119379578 missense possibly damaging 0.93
R9319:Ino80 UTSW 2 119374524 missense probably benign 0.13
R9346:Ino80 UTSW 2 119426958 missense possibly damaging 0.54
R9370:Ino80 UTSW 2 119402367 missense probably damaging 1.00
R9621:Ino80 UTSW 2 119450015 missense probably damaging 0.98
R9641:Ino80 UTSW 2 119445484 missense probably benign 0.08
R9650:Ino80 UTSW 2 119446983 missense not run
Predicted Primers PCR Primer
(F):5'- CTGTCAATATTCCAGAATGGTTGG -3'
(R):5'- TGAGTCTGGGGATCCCTTAATAC -3'

Sequencing Primer
(F):5'- CCAGAATGGTTGGATAACTTCCC -3'
(R):5'- AGAGCCTCCAAATTCATTGCTTGG -3'
Posted On 2020-11-25