Incidental Mutation 'R8257:Ddx50'
ID656474
Institutional Source Beutler Lab
Gene Symbol Ddx50
Ensembl Gene ENSMUSG00000020076
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 50
SynonymsGU2, RH-II/Gubeta, 8430408E17Rik, 4933429B04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R8257 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location62615895-62651218 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 62616520 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000020270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020270]
Predicted Effect probably benign
Transcript: ENSMUST00000020270
SMART Domains Protein: ENSMUSP00000020270
Gene: ENSMUSG00000020076

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
low complexity region 58 65 N/A INTRINSIC
Blast:DEXDc 66 104 3e-8 BLAST
low complexity region 105 122 N/A INTRINSIC
DEXDc 153 354 1.97e-52 SMART
HELICc 398 480 1.8e-28 SMART
low complexity region 558 564 N/A INTRINSIC
Pfam:GUCT 568 662 3.7e-31 PFAM
low complexity region 674 728 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box enzyme that may be involved in ribosomal RNA synthesis or processing. This gene and DDX21, also called RH-II/GuA, have similar genomic structures and are in tandem orientation on chromosome 10, suggesting that the two genes arose by gene duplication in evolution. This gene has pseudogenes on chromosomes 2, 3 and 4. Alternative splicing of this gene generates multiple transcript variants, but the full length nature of all the other variants but one has not been defined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A G 6: 48,932,497 T559A probably benign Het
4930407I10Rik A G 15: 82,065,952 K1350R probably benign Het
4933407L21Rik T A 1: 85,931,339 C70* probably null Het
Akr1c6 G A 13: 4,438,526 V97I probably benign Het
Alg9 A T 9: 50,779,087 I130F possibly damaging Het
Ankle2 G T 5: 110,253,915 probably null Het
Ankrd34a A T 3: 96,597,729 H83L possibly damaging Het
Ate1 T C 7: 130,467,307 Y367C probably damaging Het
Atg9b C T 5: 24,386,305 probably benign Het
Atp2c1 A G 9: 105,431,557 S626P probably benign Het
Ccdc171 A G 4: 83,696,369 N1069S probably damaging Het
Cdh20 A G 1: 104,994,237 D753G probably benign Het
Cdk11b A G 4: 155,647,941 E517G unknown Het
Chst5 A T 8: 111,890,460 V176E probably damaging Het
Dspp A G 5: 104,177,001 D410G probably benign Het
Dync1h1 T A 12: 110,636,474 V2183E probably damaging Het
Emilin2 A G 17: 71,274,000 V577A probably benign Het
Entpd2 T A 2: 25,398,121 L119Q probably damaging Het
Foxa1 A T 12: 57,543,146 M96K probably benign Het
Ggnbp2 C T 11: 84,837,989 probably null Het
H2-Aa T C 17: 34,283,237 T237A probably damaging Het
Itih4 G A 14: 30,887,868 V52I possibly damaging Het
Kntc1 T C 5: 123,758,523 probably null Het
Lgi4 A T 7: 31,067,341 probably null Het
Map4k2 G A 19: 6,346,000 R455H probably benign Het
Masp2 A G 4: 148,603,040 T95A possibly damaging Het
Mtmr12 T C 15: 12,259,598 I351T possibly damaging Het
Ncdn A G 4: 126,749,883 probably null Het
Nckipsd A G 9: 108,814,928 E516G probably benign Het
Nlrp12 A G 7: 3,249,332 W70R probably damaging Het
Nmral1 T A 16: 4,716,403 D58V probably damaging Het
Nr2c1 A G 10: 94,192,907 Y522C probably damaging Het
Olfr1369-ps1 A G 13: 21,116,373 N227S probably benign Het
Olfr1532-ps1 A G 7: 106,914,719 I174V probably benign Het
Olfr297 A G 7: 86,527,470 T238A possibly damaging Het
Olfr382 A G 11: 73,516,377 M274T probably benign Het
Pcdhga6 T A 18: 37,708,815 N529K probably benign Het
Pkmyt1 C T 17: 23,734,174 R235W probably benign Het
Prss43 T C 9: 110,830,812 S315P possibly damaging Het
Psmd1 T A 1: 86,078,623 V237E probably damaging Het
Ptprf A G 4: 118,226,279 Y844H probably damaging Het
Ryr1 C T 7: 29,064,639 V3089I possibly damaging Het
Slc1a7 A G 4: 108,008,197 D294G possibly damaging Het
Slc5a10 T A 11: 61,715,047 T148S probably damaging Het
Spata25 T C 2: 164,827,770 D107G possibly damaging Het
Stambpl1 A G 19: 34,231,501 E132G probably damaging Het
Tgfb1 A G 7: 25,696,948 H222R probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Trmt1l T A 1: 151,428,878 M1K probably null Het
Vmn2r86 A T 10: 130,452,410 H407Q possibly damaging Het
Wdr36 T A 18: 32,841,286 probably benign Het
Zfp35 T A 18: 24,004,231 I544N possibly damaging Het
Other mutations in Ddx50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01517:Ddx50 APN 10 62647132 missense probably benign
IGL01955:Ddx50 APN 10 62647183 missense probably benign
IGL02677:Ddx50 APN 10 62616293 missense unknown
IGL03169:Ddx50 APN 10 62621387 critical splice donor site probably null
IGL03372:Ddx50 APN 10 62643330 missense probably benign 0.11
K7371:Ddx50 UTSW 10 62621510 start codon destroyed probably null
R0123:Ddx50 UTSW 10 62621377 splice site probably benign
R0134:Ddx50 UTSW 10 62621377 splice site probably benign
R0318:Ddx50 UTSW 10 62642837 missense probably damaging 1.00
R0731:Ddx50 UTSW 10 62616249 missense unknown
R1244:Ddx50 UTSW 10 62642924 missense probably damaging 1.00
R1429:Ddx50 UTSW 10 62647068 missense possibly damaging 0.45
R2005:Ddx50 UTSW 10 62640464 missense probably benign 0.10
R2924:Ddx50 UTSW 10 62627594 missense probably damaging 1.00
R3803:Ddx50 UTSW 10 62639944 missense probably damaging 1.00
R3861:Ddx50 UTSW 10 62642946 missense possibly damaging 0.91
R4169:Ddx50 UTSW 10 62640770 nonsense probably null
R4917:Ddx50 UTSW 10 62627671 nonsense probably null
R4918:Ddx50 UTSW 10 62627671 nonsense probably null
R4951:Ddx50 UTSW 10 62634120 missense probably damaging 0.99
R4962:Ddx50 UTSW 10 62642853 missense probably damaging 1.00
R5102:Ddx50 UTSW 10 62640861 missense probably damaging 1.00
R5403:Ddx50 UTSW 10 62647030 missense probably benign
R5648:Ddx50 UTSW 10 62616270 missense unknown
R5899:Ddx50 UTSW 10 62640817 nonsense probably null
R6127:Ddx50 UTSW 10 62621563 splice site probably null
R6244:Ddx50 UTSW 10 62621566 splice site probably null
R8098:Ddx50 UTSW 10 62625143 critical splice donor site probably null
R8163:Ddx50 UTSW 10 62639899 missense possibly damaging 0.93
R8272:Ddx50 UTSW 10 62621477 missense probably benign 0.05
R8356:Ddx50 UTSW 10 62621508 missense probably benign 0.04
R8537:Ddx50 UTSW 10 62642849 missense probably damaging 1.00
R8540:Ddx50 UTSW 10 62640790 missense possibly damaging 0.94
R8759:Ddx50 UTSW 10 62616242 missense unknown
X0026:Ddx50 UTSW 10 62625191 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCTGTCTACCTGATCGGC -3'
(R):5'- TGAGAATCTTGGAATGGATCTGAGG -3'

Sequencing Primer
(F):5'- TGATCGGCCACCAGATCGAC -3'
(R):5'- CTTAGCCTGATGACTGAGAATCG -3'
Posted On2020-11-25