Incidental Mutation 'R8337:Itk'
ID656495
Institutional Source Beutler Lab
Gene Symbol Itk
Ensembl Gene ENSMUSG00000020395
Gene NameIL2 inducible T cell kinase
SynonymsEmt, Tsk, Tcsk
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R8337 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location46325150-46389515 bp(-) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) T to C at 46342395 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020664] [ENSMUST00000101306] [ENSMUST00000109237]
PDB Structure INTRAMOLECULAR ITK-PROLINE COMPLEX, NMR, MINIMIZED AVERAGE STRUCTURE [SOLUTION NMR]
NMR Structures of Itk SH2 domain, Pro287cis isoform, ensemble of 20 low energy structures [SOLUTION NMR]
NMR Structure of the Itk SH2 domain, Pro287cis, Energy minimized average structure [SOLUTION NMR]
NMR Structure of the Itk SH2 domain, Pro287trans, 20 low energy structures [SOLUTION NMR]
NMR Structure of the Itk SH2 domain, Pro287trans, energy minimized average structure [SOLUTION NMR]
The NMR minimized average structure of the Itk SH2 domain bound to a phosphopeptide [SOLUTION NMR]
The NMR ensemble structure of the Itk SH2 domain bound to a phosphopeptide [SOLUTION NMR]
Solution Structure of the binary complex between the SH3 and SH2 domain of interleukin-2 tyrosine kinase [SOLUTION NMR]
Ensemble Structures of the binary complex between the SH3 and SH2 domain of interleukin-2 tyrosine kinase. [SOLUTION NMR]
NMR structure note: murine Itk SH3 domain [SOLUTION NMR]
>> 2 additional structures at PDB <<
Predicted Effect probably null
Transcript: ENSMUST00000020664
SMART Domains Protein: ENSMUSP00000020664
Gene: ENSMUSG00000020395

DomainStartEndE-ValueType
PH 5 113 2.3e-13 SMART
BTK 113 149 1.1e-21 SMART
SH3 174 230 5.87e-14 SMART
SH2 237 328 9.44e-29 SMART
TyrKc 362 611 3.28e-133 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101306
SMART Domains Protein: ENSMUSP00000098864
Gene: ENSMUSG00000020395

DomainStartEndE-ValueType
PH 5 113 2.3e-13 SMART
BTK 113 149 1.1e-21 SMART
SH3 174 230 5.87e-14 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109237
SMART Domains Protein: ENSMUSP00000104860
Gene: ENSMUSG00000020395

DomainStartEndE-ValueType
PH 5 119 3.94e-12 SMART
BTK 119 155 1.1e-21 SMART
SH3 180 236 5.87e-14 SMART
SH2 243 334 9.44e-29 SMART
TyrKc 368 617 3.28e-133 SMART
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intracellular tyrosine kinase expressed in T-cells. The protein contains both SH2 and SH3 domains which are often found in intracellular kinases. It is thought to play a role in T-cell proliferation and differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display decreased percentages of CD4 and CD8 cells, increased percentage of B cells, impaired T cell receptor signaling, and increased susceptibility to Toxoplasma gondii infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik T C 16: 88,759,263 Y122H probably damaging Het
Abhd14b T A 9: 106,450,041 H7Q probably benign Het
Acod1 C T 14: 103,049,344 R28W possibly damaging Het
Agap2 A G 10: 127,088,325 T803A unknown Het
Angptl7 T C 4: 148,497,284 E215G probably damaging Het
Ankrd34c T A 9: 89,729,898 D130V probably damaging Het
BC028528 A G 3: 95,884,986 V144A probably benign Het
Cab39l T C 14: 59,539,191 F274L probably damaging Het
Cdsn T C 17: 35,555,518 S315P possibly damaging Het
Celsr3 CGGGG CGGGGG 9: 108,841,272 probably null Het
Cep97 A T 16: 55,915,031 L540* probably null Het
Chrna2 G T 14: 66,149,568 E388* probably null Het
Ckap4 A G 10: 84,528,596 V201A probably damaging Het
Clec4b1 A G 6: 123,065,963 K47R probably benign Het
Clvs2 A T 10: 33,528,488 I244N possibly damaging Het
Cmtr1 G A 17: 29,674,177 E57K probably benign Het
Cxxc1 T A 18: 74,220,839 D565E possibly damaging Het
Dpcr1 T C 17: 35,637,594 H371R possibly damaging Het
Dtx3l T A 16: 35,933,703 M178L probably benign Het
Eml2 A G 7: 19,196,236 D294G possibly damaging Het
Flt3 A G 5: 147,332,888 probably null Het
Frs3 T A 17: 47,703,852 L490Q probably damaging Het
Gm14085 C T 2: 122,525,136 T603I probably benign Het
Gm35339 T C 15: 76,361,484 V1307A Het
Gm6882 G A 7: 21,427,634 T103I possibly damaging Het
Gsdmd C T 15: 75,864,421 T133I probably benign Het
Hhipl2 C A 1: 183,428,632 C331* probably null Het
Ifnar1 C A 16: 91,505,336 D566E possibly damaging Het
Ighv1-34 A T 12: 114,851,319 N74K probably benign Het
Kdm7a T C 6: 39,145,527 D801G probably benign Het
March1 T C 8: 66,418,989 L139P probably damaging Het
Metap1d T C 2: 71,515,638 V181A probably damaging Het
Mfsd8 G A 3: 40,835,193 R140C probably damaging Het
Mrps25 T C 6: 92,175,764 T92A probably benign Het
Ntng2 C A 2: 29,248,038 M1I probably null Het
Olfr635 A C 7: 103,979,374 M61L probably damaging Het
Olfr64 C T 7: 103,893,049 G229R probably benign Het
Olfr983 T C 9: 40,092,399 K189R probably benign Het
Pla2g12a A G 3: 129,878,816 D33G probably damaging Het
Prlhr A G 19: 60,467,846 V94A possibly damaging Het
Ralgapb T A 2: 158,450,272 S793T probably benign Het
Rapgef6 T A 11: 54,631,301 L455* probably null Het
Sbf2 T C 7: 110,441,462 H386R probably benign Het
Sec23ip C A 7: 128,764,025 N539K probably damaging Het
Shisa4 A G 1: 135,373,169 L121P probably damaging Het
Stard9 T A 2: 120,679,825 F296I probably damaging Het
Strn3 T C 12: 51,661,172 K147E probably damaging Het
Taf5l T C 8: 123,998,102 N326S probably benign Het
Tfb2m T A 1: 179,542,349 I170L probably benign Het
Tfec T C 6: 16,845,423 N79S possibly damaging Het
Tnn C T 1: 160,118,483 G922R probably damaging Het
Tox3 T C 8: 90,347,879 Y24C probably damaging Het
Vmn2r6 A T 3: 64,556,105 L436* probably null Het
Vmn2r80 A G 10: 79,148,873 I20V probably benign Het
Other mutations in Itk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Itk APN 11 46367896 missense probably damaging 1.00
IGL01349:Itk APN 11 46341200 missense possibly damaging 0.84
IGL03290:Itk APN 11 46334937 missense probably damaging 1.00
IGL03385:Itk APN 11 46331861 nonsense probably null
Calame UTSW 11 46342395 splice site probably null
carbone UTSW 11 46331949 nonsense probably null
goodnow UTSW 11 46338099 splice site probably null
itxaro UTSW 11 46338217 missense probably damaging 1.00
BB009:Itk UTSW 11 46340692 missense probably benign
BB019:Itk UTSW 11 46340692 missense probably benign
R0095:Itk UTSW 11 46342452 missense probably damaging 0.99
R0265:Itk UTSW 11 46389458 start gained probably benign
R0281:Itk UTSW 11 46353916 missense probably damaging 1.00
R0463:Itk UTSW 11 46331989 missense probably damaging 1.00
R0518:Itk UTSW 11 46360288 missense probably damaging 0.98
R0521:Itk UTSW 11 46360288 missense probably damaging 0.98
R1121:Itk UTSW 11 46331894 missense possibly damaging 0.93
R1550:Itk UTSW 11 46389326 missense probably damaging 1.00
R1762:Itk UTSW 11 46336482 missense probably damaging 0.98
R2418:Itk UTSW 11 46338217 missense probably damaging 1.00
R2419:Itk UTSW 11 46338217 missense probably damaging 1.00
R2859:Itk UTSW 11 46344835 intron probably benign
R3107:Itk UTSW 11 46327464 missense probably benign 0.15
R3546:Itk UTSW 11 46355848 missense probably benign 0.00
R4601:Itk UTSW 11 46336515 missense probably benign 0.17
R4610:Itk UTSW 11 46336515 missense probably benign 0.17
R4792:Itk UTSW 11 46344831 intron probably benign
R4885:Itk UTSW 11 46336344 splice site probably null
R4934:Itk UTSW 11 46389325 missense probably damaging 1.00
R5286:Itk UTSW 11 46338099 splice site probably null
R5328:Itk UTSW 11 46331876 missense probably benign 0.04
R5399:Itk UTSW 11 46338111 missense probably benign 0.44
R5958:Itk UTSW 11 46344855 intron probably benign
R6235:Itk UTSW 11 46336428 missense probably benign 0.16
R6828:Itk UTSW 11 46341218 missense probably damaging 1.00
R6849:Itk UTSW 11 46331935 missense probably damaging 1.00
R7356:Itk UTSW 11 46367832 missense possibly damaging 0.72
R7753:Itk UTSW 11 46331895 missense probably damaging 1.00
R7932:Itk UTSW 11 46340692 missense probably benign
R7988:Itk UTSW 11 46355834 missense probably damaging 0.99
R8188:Itk UTSW 11 46331949 nonsense probably null
R8738:Itk UTSW 11 46340712 missense probably damaging 1.00
U24488:Itk UTSW 11 46338144 missense probably damaging 1.00
X0062:Itk UTSW 11 46366044 missense probably benign 0.15
Z1088:Itk UTSW 11 46353862 splice site probably null
Predicted Primers PCR Primer
(F):5'- TCTGGTATCCACCCAGTTCTGG -3'
(R):5'- TGCTACTGAAAGTCTGTGCC -3'

Sequencing Primer
(F):5'- ACCCAGTTCTGGCCCTTATTAAATC -3'
(R):5'- GTGCCACACAGTGCTTCC -3'
Posted On2020-12-02