Incidental Mutation 'R8301:Prl3c1'
ID 656517
Institutional Source Beutler Lab
Gene Symbol Prl3c1
Ensembl Gene ENSMUSG00000017922
Gene Name prolactin family 3, subfamily c, member 1
Synonyms Prlpj, PLP-J, PLP I
MMRRC Submission
Accession Numbers

Genbank: NM_013766, NM_001163218

Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock # R8301 (G1)
Quality Score 161.009
Status Validated
Chromosome 13
Chromosomal Location 27196659-27203749 bp(+) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) A to C at 27199185 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018066] [ENSMUST00000110364] [ENSMUST00000178072]
AlphaFold Q9QUN5
Predicted Effect probably benign
Transcript: ENSMUST00000018066
SMART Domains Protein: ENSMUSP00000018066
Gene: ENSMUSG00000017922

DomainStartEndE-ValueType
Pfam:Hormone_1 16 212 1.5e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110364
SMART Domains Protein: ENSMUSP00000105993
Gene: ENSMUSG00000017922

DomainStartEndE-ValueType
Pfam:Hormone_1 2 192 2.9e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178072
SMART Domains Protein: ENSMUSP00000136890
Gene: ENSMUSG00000017922

DomainStartEndE-ValueType
Pfam:Hormone_1 2 192 2.9e-31 PFAM
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (71/71)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced female fertility and a male reproductive tract phenotype that includes enlarged testes and seminal vesicles, increased sperm count, increased serum testosterone and luteinizing hormone levels, and abnormal adult Leydig cell differentiation. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 87,972,505 I374F probably benign Het
9430076C15Rik A G 6: 53,681,033 D116G possibly damaging Het
Ak9 G A 10: 41,424,716 V1108I Het
Aldh16a1 C T 7: 45,141,982 A790T possibly damaging Het
Anks1 A T 17: 28,059,580 probably benign Het
Antxr2 T G 5: 97,977,679 T240P probably benign Het
Arfgef1 A T 1: 10,179,833 M945K probably damaging Het
Arhgef17 T C 7: 100,879,659 T1591A probably benign Het
Aurka A G 2: 172,356,930 S374P probably damaging Het
Bccip T C 7: 133,719,204 S236P probably benign Het
Cacna1s T A 1: 136,073,441 probably benign Het
Calm1 A G 12: 100,205,685 E132G probably benign Het
Casz1 A G 4: 148,946,043 D1173G probably damaging Het
Cdh17 A G 4: 11,795,659 D413G probably damaging Het
Cfap57 A G 4: 118,593,074 I617T possibly damaging Het
Csnka2ip A C 16: 64,478,991 S337A unknown Het
Ddx60 A G 8: 62,000,597 E1250G probably benign Het
Dlgap2 T A 8: 14,823,577 S727T probably benign Het
Dpy19l1 T C 9: 24,485,111 probably benign Het
Ebf2 A G 14: 67,238,982 T134A possibly damaging Het
Echdc2 A T 4: 108,172,909 M136L probably benign Het
Enpp2 A G 15: 54,851,407 F598S probably benign Het
Extl3 A C 14: 65,076,284 L483R probably damaging Het
Gcat T C 15: 79,035,889 V227A possibly damaging Het
Hsf2 A G 10: 57,505,346 D344G probably damaging Het
Ighm C T 12: 113,421,545 G265D Het
Igsf9b T G 9: 27,334,739 probably benign Het
Ints6 A G 14: 62,702,453 V596A probably benign Het
Ints8 T C 4: 11,246,120 E182G probably damaging Het
Iqgap2 A G 13: 95,682,151 probably null Het
Kalrn G T 16: 34,357,100 Q250K probably benign Het
Lrrc1 T A 9: 77,544,488 N46Y probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naa50 A G 16: 44,157,131 N74S probably benign Het
Neb T C 2: 52,288,835 N1303S probably benign Het
Nfs1 A T 2: 156,134,493 C160* probably null Het
Olfr472 A G 7: 107,903,626 K303R probably benign Het
Olfr591 T G 7: 103,173,073 K188T probably damaging Het
Olfr740 T A 14: 50,453,564 S171T probably benign Het
Olfr809 T C 10: 129,776,840 S309P probably benign Het
Orm2 T C 4: 63,363,026 F67S possibly damaging Het
Pex5 A G 6: 124,405,183 S180P probably benign Het
Phf14 G C 6: 11,992,062 G746R probably damaging Het
Pkm T A 9: 59,668,631 V110E probably damaging Het
Plekha6 T G 1: 133,264,687 N78K probably damaging Het
Plxna2 G A 1: 194,790,175 V1076I probably benign Het
Polq C A 16: 37,061,819 D1448E probably damaging Het
Pot1b T C 17: 55,687,895 T256A probably benign Het
Prkch C T 12: 73,702,764 T377I possibly damaging Het
Prl7b1 A C 13: 27,602,772 V158G possibly damaging Het
Prss22 T C 17: 23,993,981 S261G probably damaging Het
Psd T C 19: 46,321,102 probably benign Het
Psg18 A T 7: 18,353,377 Y119N probably damaging Het
Rbm6 T G 9: 107,852,794 R218S probably damaging Het
Rnf213 T A 11: 119,434,742 S1491T Het
Rsf1 T C 7: 97,661,925 S621P Het
Runx1 C A 16: 92,605,656 *466L probably null Het
Samd4 A G 14: 47,016,678 I200V probably benign Het
Sdsl C T 5: 120,459,519 C241Y probably benign Het
Sepn1 T C 4: 134,551,414 probably benign Het
Setx C T 2: 29,145,690 P729L possibly damaging Het
Sf1 C T 19: 6,368,366 Q55* probably null Het
Slc12a5 A T 2: 164,993,691 N833I probably damaging Het
Slc1a4 T C 11: 20,332,286 R63G probably damaging Het
Tmeff2 G T 1: 51,181,837 A324S probably benign Het
Tmem217 A G 17: 29,526,492 I88T possibly damaging Het
Tnfsf8 A T 4: 63,860,878 I61N probably benign Het
Tpbgl G T 7: 99,625,567 A361E probably damaging Het
Trhde T A 10: 114,487,006 E667V probably benign Het
Unc13b A G 4: 43,263,568 T1598A probably benign Het
Vmn2r73 A T 7: 85,858,302 C601S probably benign Het
Zfp873 C A 10: 82,060,879 H481Q probably damaging Het
Other mutations in Prl3c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Prl3c1 APN 13 27200763 missense probably damaging 0.97
IGL00567:Prl3c1 APN 13 27200712 missense possibly damaging 0.82
IGL01105:Prl3c1 APN 13 27202425 missense probably benign 0.04
IGL02985:Prl3c1 APN 13 27199387 missense probably damaging 0.99
IGL03013:Prl3c1 APN 13 27199366 missense probably benign 0.01
G1Funyon:Prl3c1 UTSW 13 27199185 unclassified probably benign
H8930:Prl3c1 UTSW 13 27200706 nonsense probably null
R0437:Prl3c1 UTSW 13 27199464 missense probably benign 0.09
R0630:Prl3c1 UTSW 13 27200691 splice site probably benign
R1277:Prl3c1 UTSW 13 27203572 missense probably damaging 1.00
R2064:Prl3c1 UTSW 13 27196737 critical splice donor site probably null
R2121:Prl3c1 UTSW 13 27199342 splice site probably null
R4752:Prl3c1 UTSW 13 27203525 missense probably benign 0.11
R4959:Prl3c1 UTSW 13 27202488 splice site probably null
R5863:Prl3c1 UTSW 13 27203610 makesense probably null
R7912:Prl3c1 UTSW 13 27199384 missense probably benign 0.02
R7913:Prl3c1 UTSW 13 27199410 missense probably benign 0.00
R8157:Prl3c1 UTSW 13 27199347 missense probably damaging 1.00
R8352:Prl3c1 UTSW 13 27202402 missense probably benign 0.01
R8452:Prl3c1 UTSW 13 27202402 missense probably benign 0.01
R8898:Prl3c1 UTSW 13 27203595 missense possibly damaging 0.93
Z1177:Prl3c1 UTSW 13 27203501 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TTAAGTGCTCTTAACCACTGGGG -3'
(R):5'- AGGAACATGCATGACACCAACAG -3'

Sequencing Primer
(F):5'- GGCCAAGCAGTCCCTCTTATAG -3'
(R):5'- AGGAACAGACCCTTCCCTG -3'
Posted On 2020-12-09