Incidental Mutation 'R8301:Psd'
ID 656519
Institutional Source Beutler Lab
Gene Symbol Psd
Ensembl Gene ENSMUSG00000037126
Gene Name pleckstrin and Sec7 domain containing
Synonyms Efa6, Psdl, Efa6a, 1110007H17Rik
MMRRC Submission 067789-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8301 (G1)
Quality Score 178.009
Status Validated
Chromosome 19
Chromosomal Location 46300526-46315595 bp(-) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) T to C at 46309541 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000093729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041391] [ENSMUST00000096029]
AlphaFold Q5DTT2
Predicted Effect probably benign
Transcript: ENSMUST00000041391
SMART Domains Protein: ENSMUSP00000039728
Gene: ENSMUSG00000037126

DomainStartEndE-ValueType
low complexity region 48 63 N/A INTRINSIC
low complexity region 79 99 N/A INTRINSIC
low complexity region 329 368 N/A INTRINSIC
low complexity region 419 431 N/A INTRINSIC
low complexity region 445 466 N/A INTRINSIC
Sec7 519 708 5.08e-75 SMART
low complexity region 714 724 N/A INTRINSIC
low complexity region 736 744 N/A INTRINSIC
PH 757 871 1.87e-13 SMART
Blast:Sec7 900 952 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000096029
SMART Domains Protein: ENSMUSP00000093729
Gene: ENSMUSG00000037126

DomainStartEndE-ValueType
low complexity region 48 63 N/A INTRINSIC
low complexity region 79 99 N/A INTRINSIC
low complexity region 329 368 N/A INTRINSIC
low complexity region 419 431 N/A INTRINSIC
low complexity region 445 466 N/A INTRINSIC
Sec7 520 709 5.08e-75 SMART
low complexity region 715 725 N/A INTRINSIC
low complexity region 737 745 N/A INTRINSIC
PH 758 872 1.87e-13 SMART
Blast:Sec7 901 953 1e-6 BLAST
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Plekstrin homology and SEC7 domains-containing protein that functions as a guanine nucleotide exchange factor. The encoded protein regulates signal transduction by activating ADP-ribosylation factor 6. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 88,120,364 (GRCm39) I374F probably benign Het
Ak9 G A 10: 41,300,712 (GRCm39) V1108I Het
Aldh16a1 C T 7: 44,791,406 (GRCm39) A790T possibly damaging Het
Anks1 A T 17: 28,278,554 (GRCm39) probably benign Het
Antxr2 T G 5: 98,125,538 (GRCm39) T240P probably benign Het
Arfgef1 A T 1: 10,250,058 (GRCm39) M945K probably damaging Het
Arhgef17 T C 7: 100,528,866 (GRCm39) T1591A probably benign Het
Aurka A G 2: 172,198,850 (GRCm39) S374P probably damaging Het
Bccip T C 7: 133,320,933 (GRCm39) S236P probably benign Het
Cacna1s T A 1: 136,001,179 (GRCm39) probably benign Het
Calm1 A G 12: 100,171,944 (GRCm39) E132G probably benign Het
Casz1 A G 4: 149,030,500 (GRCm39) D1173G probably damaging Het
Cdh17 A G 4: 11,795,659 (GRCm39) D413G probably damaging Het
Cfap57 A G 4: 118,450,271 (GRCm39) I617T possibly damaging Het
Creb5 A G 6: 53,658,018 (GRCm39) D116G possibly damaging Het
Csnka2ip A C 16: 64,299,354 (GRCm39) S337A unknown Het
Ddx60 A G 8: 62,453,631 (GRCm39) E1250G probably benign Het
Dlgap2 T A 8: 14,873,577 (GRCm39) S727T probably benign Het
Dpy19l1 T C 9: 24,396,407 (GRCm39) probably benign Het
Ebf2 A G 14: 67,476,431 (GRCm39) T134A possibly damaging Het
Echdc2 A T 4: 108,030,106 (GRCm39) M136L probably benign Het
Enpp2 A G 15: 54,714,803 (GRCm39) F598S probably benign Het
Extl3 A C 14: 65,313,733 (GRCm39) L483R probably damaging Het
Gcat T C 15: 78,920,089 (GRCm39) V227A possibly damaging Het
Hsf2 A G 10: 57,381,442 (GRCm39) D344G probably damaging Het
Ighm C T 12: 113,385,165 (GRCm39) G265D Het
Igsf9b T G 9: 27,246,035 (GRCm39) probably benign Het
Ints6 A G 14: 62,939,902 (GRCm39) V596A probably benign Het
Ints8 T C 4: 11,246,120 (GRCm39) E182G probably damaging Het
Iqgap2 A G 13: 95,818,659 (GRCm39) probably null Het
Kalrn G T 16: 34,177,470 (GRCm39) Q250K probably benign Het
Lrrc1 T A 9: 77,451,770 (GRCm39) N46Y probably damaging Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Naa50 A G 16: 43,977,494 (GRCm39) N74S probably benign Het
Neb T C 2: 52,178,847 (GRCm39) N1303S probably benign Het
Nfs1 A T 2: 155,976,413 (GRCm39) C160* probably null Het
Or11g7 T A 14: 50,691,021 (GRCm39) S171T probably benign Het
Or52s1b T G 7: 102,822,280 (GRCm39) K188T probably damaging Het
Or5p52 A G 7: 107,502,833 (GRCm39) K303R probably benign Het
Or6c76 T C 10: 129,612,709 (GRCm39) S309P probably benign Het
Orm2 T C 4: 63,281,263 (GRCm39) F67S possibly damaging Het
Pex5 A G 6: 124,382,142 (GRCm39) S180P probably benign Het
Phf14 G C 6: 11,992,061 (GRCm39) G746R probably damaging Het
Pkm T A 9: 59,575,914 (GRCm39) V110E probably damaging Het
Plekha6 T G 1: 133,192,425 (GRCm39) N78K probably damaging Het
Plxna2 G A 1: 194,472,483 (GRCm39) V1076I probably benign Het
Polq C A 16: 36,882,181 (GRCm39) D1448E probably damaging Het
Pot1b T C 17: 55,994,895 (GRCm39) T256A probably benign Het
Prkch C T 12: 73,749,538 (GRCm39) T377I possibly damaging Het
Prl3c1 A C 13: 27,383,168 (GRCm39) probably benign Het
Prl7b1 A C 13: 27,786,755 (GRCm39) V158G possibly damaging Het
Prss22 T C 17: 24,212,955 (GRCm39) S261G probably damaging Het
Psg18 A T 7: 18,087,302 (GRCm39) Y119N probably damaging Het
Rbm6 T G 9: 107,729,993 (GRCm39) R218S probably damaging Het
Rnf213 T A 11: 119,325,568 (GRCm39) S1491T Het
Rsf1 T C 7: 97,311,132 (GRCm39) S621P Het
Runx1 C A 16: 92,402,544 (GRCm39) *466L probably null Het
Samd4 A G 14: 47,254,135 (GRCm39) I200V probably benign Het
Sdsl C T 5: 120,597,584 (GRCm39) C241Y probably benign Het
Selenon T C 4: 134,278,725 (GRCm39) probably benign Het
Setx C T 2: 29,035,702 (GRCm39) P729L possibly damaging Het
Sf1 C T 19: 6,418,396 (GRCm39) Q55* probably null Het
Slc12a5 A T 2: 164,835,611 (GRCm39) N833I probably damaging Het
Slc1a4 T C 11: 20,282,286 (GRCm39) R63G probably damaging Het
Tmeff2 G T 1: 51,220,996 (GRCm39) A324S probably benign Het
Tmem217 A G 17: 29,745,466 (GRCm39) I88T possibly damaging Het
Tnfsf8 A T 4: 63,779,115 (GRCm39) I61N probably benign Het
Tpbgl G T 7: 99,274,774 (GRCm39) A361E probably damaging Het
Trhde T A 10: 114,322,911 (GRCm39) E667V probably benign Het
Unc13b A G 4: 43,263,568 (GRCm39) T1598A probably benign Het
Vmn2r73 A T 7: 85,507,510 (GRCm39) C601S probably benign Het
Zfp873 C A 10: 81,896,713 (GRCm39) H481Q probably damaging Het
Other mutations in Psd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01291:Psd APN 19 46,303,186 (GRCm39) missense possibly damaging 0.77
IGL01307:Psd APN 19 46,303,097 (GRCm39) missense probably damaging 1.00
IGL02329:Psd APN 19 46,308,098 (GRCm39) missense possibly damaging 0.66
IGL02423:Psd APN 19 46,302,943 (GRCm39) missense possibly damaging 0.95
IGL02644:Psd APN 19 46,311,834 (GRCm39) missense probably damaging 1.00
IGL02724:Psd APN 19 46,307,984 (GRCm39) missense probably benign 0.04
IGL03117:Psd APN 19 46,311,561 (GRCm39) unclassified probably benign
ANU05:Psd UTSW 19 46,303,186 (GRCm39) missense possibly damaging 0.77
G1Funyon:Psd UTSW 19 46,309,541 (GRCm39) intron probably benign
P0035:Psd UTSW 19 46,309,400 (GRCm39) missense possibly damaging 0.56
R0054:Psd UTSW 19 46,311,781 (GRCm39) missense probably damaging 1.00
R0054:Psd UTSW 19 46,311,781 (GRCm39) missense probably damaging 1.00
R0403:Psd UTSW 19 46,309,411 (GRCm39) unclassified probably benign
R0499:Psd UTSW 19 46,310,600 (GRCm39) missense probably damaging 0.98
R0542:Psd UTSW 19 46,302,649 (GRCm39) missense probably damaging 1.00
R0543:Psd UTSW 19 46,307,956 (GRCm39) missense possibly damaging 0.62
R0894:Psd UTSW 19 46,301,880 (GRCm39) missense probably damaging 1.00
R1449:Psd UTSW 19 46,313,250 (GRCm39) missense probably damaging 0.99
R1586:Psd UTSW 19 46,303,237 (GRCm39) missense probably damaging 0.98
R2096:Psd UTSW 19 46,313,088 (GRCm39) splice site probably null
R2504:Psd UTSW 19 46,313,352 (GRCm39) missense possibly damaging 0.90
R2857:Psd UTSW 19 46,312,859 (GRCm39) missense probably benign 0.00
R2863:Psd UTSW 19 46,303,201 (GRCm39) missense probably damaging 0.97
R3897:Psd UTSW 19 46,313,024 (GRCm39) missense possibly damaging 0.93
R3967:Psd UTSW 19 46,312,845 (GRCm39) missense probably benign
R3970:Psd UTSW 19 46,312,845 (GRCm39) missense probably benign
R4435:Psd UTSW 19 46,302,933 (GRCm39) missense probably damaging 1.00
R4612:Psd UTSW 19 46,301,778 (GRCm39) missense probably benign 0.15
R4940:Psd UTSW 19 46,310,856 (GRCm39) missense probably damaging 1.00
R5055:Psd UTSW 19 46,310,907 (GRCm39) missense probably benign 0.00
R5485:Psd UTSW 19 46,304,528 (GRCm39) splice site probably null
R5768:Psd UTSW 19 46,301,178 (GRCm39) missense possibly damaging 0.84
R5775:Psd UTSW 19 46,303,211 (GRCm39) nonsense probably null
R6057:Psd UTSW 19 46,311,753 (GRCm39) missense possibly damaging 0.77
R6349:Psd UTSW 19 46,301,826 (GRCm39) splice site probably null
R6496:Psd UTSW 19 46,308,753 (GRCm39) missense probably damaging 1.00
R6614:Psd UTSW 19 46,301,851 (GRCm39) missense probably benign 0.11
R6820:Psd UTSW 19 46,309,283 (GRCm39) missense probably damaging 1.00
R6849:Psd UTSW 19 46,306,185 (GRCm39) missense probably damaging 0.97
R6860:Psd UTSW 19 46,310,858 (GRCm39) missense probably damaging 1.00
R7286:Psd UTSW 19 46,303,240 (GRCm39) missense probably damaging 0.98
R7326:Psd UTSW 19 46,312,893 (GRCm39) missense probably benign 0.01
R7351:Psd UTSW 19 46,310,869 (GRCm39) missense probably benign 0.27
R7593:Psd UTSW 19 46,301,352 (GRCm39) missense possibly damaging 0.47
R7614:Psd UTSW 19 46,301,877 (GRCm39) missense probably damaging 1.00
R7943:Psd UTSW 19 46,313,169 (GRCm39) missense possibly damaging 0.54
R8498:Psd UTSW 19 46,312,788 (GRCm39) missense probably damaging 1.00
R8712:Psd UTSW 19 46,301,775 (GRCm39) missense probably damaging 1.00
R8952:Psd UTSW 19 46,310,900 (GRCm39) missense probably damaging 1.00
R8980:Psd UTSW 19 46,310,657 (GRCm39) missense possibly damaging 0.95
R9168:Psd UTSW 19 46,309,233 (GRCm39) missense probably damaging 1.00
R9322:Psd UTSW 19 46,301,880 (GRCm39) missense probably damaging 1.00
R9512:Psd UTSW 19 46,306,154 (GRCm39) missense possibly damaging 0.79
R9569:Psd UTSW 19 46,308,717 (GRCm39) missense possibly damaging 0.94
R9638:Psd UTSW 19 46,301,841 (GRCm39) frame shift probably null
R9645:Psd UTSW 19 46,301,841 (GRCm39) frame shift probably null
R9721:Psd UTSW 19 46,311,628 (GRCm39) missense probably benign 0.00
Z1177:Psd UTSW 19 46,313,100 (GRCm39) missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- CGGATACCAGCTGACTTAGG -3'
(R):5'- CAGCACCCCATTTATACCTGG -3'

Sequencing Primer
(F):5'- ATACCAGCTGACTTAGGGGTGG -3'
(R):5'- TATGTGCAGAGAGAAGACTGTCTTG -3'
Posted On 2020-12-09