Mutagenetix > Incidental Mutation

Incidental Mutation 'R8275:Pikfyve'

656520

Institutional Source

Beutler Lab

Gene Symbol

Pikfyve

Ensembl Gene

ENSMUSG00000025949

Gene Name

phosphoinositide kinase, FYVE type zinc finger containing

Synonyms

Pip5k3

MMRRC Submission

Accession Numbers

Genbank: NM_011086

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8275 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

65186683-65278695 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 65253342 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000095314 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081154] [ENSMUST00000097707]

AlphaFold

Q9Z1T6

Predicted Effect

probably benign
Transcript: ENSMUST00000081154

SMART Domains

Protein: ENSMUSP00000079926
Gene: ENSMUSG00000025949

Domain	Start	End	E-Value	Type
low complexity region	58	81	N/A	INTRINSIC
FYVE	161	230	5.95e-18	SMART
DEP	376	451	9.05e-27	SMART
Pfam:Cpn60_TCP1	547	822	2e-37	PFAM
low complexity region	1177	1189	N/A	INTRINSIC
low complexity region	1516	1536	N/A	INTRINSIC
PIPKc	1745	2039	3.03e-162	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000097707

SMART Domains

Protein: ENSMUSP00000095314
Gene: ENSMUSG00000025949

Domain	Start	End	E-Value	Type
low complexity region	58	81	N/A	INTRINSIC
FYVE	150	219	5.95e-18	SMART
DEP	365	440	9.05e-27	SMART
Pfam:Cpn60_TCP1	590	864	1.8e-35	PFAM
low complexity region	1222	1234	N/A	INTRINSIC
low complexity region	1561	1581	N/A	INTRINSIC
PIPKc	1790	2084	3.03e-162	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

100% (39/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylated derivatives of phosphatidylinositol (PtdIns) regulate cytoskeletal functions, membrane trafficking, and receptor signaling by recruiting protein complexes to cell- and endosomal-membranes. Humans have multiple PtdIns proteins that differ by the degree and position of phosphorylation of the inositol ring. This gene encodes an enzyme (PIKfyve; also known as phosphatidylinositol-3-phosphate 5-kinase type III or PIPKIII) that phosphorylates the D-5 position in PtdIns and phosphatidylinositol-3-phosphate (PtdIns3P) to make PtdIns5P and PtdIns(3,5)biphosphate. The D-5 position also can be phosphorylated by type I PtdIns4P-5-kinases (PIP5Ks) that are encoded by distinct genes and preferentially phosphorylate D-4 phosphorylated PtdIns. In contrast, PIKfyve preferentially phosphorylates D-3 phosphorylated PtdIns. In addition to being a lipid kinase, PIKfyve also has protein kinase activity. PIKfyve regulates endomembrane homeostasis and plays a role in the biogenesis of endosome carrier vesicles from early endosomes. Mutations in this gene cause corneal fleck dystrophy (CFD); an autosomal dominant disorder characterized by numerous small white flecks present in all layers of the corneal stroma. Histologically, these flecks appear to be keratocytes distended with lipid and mucopolysaccharide filled intracytoplasmic vacuoles. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele die prior to implantation with reduced numbers of inner cell mass and trophectoderm cells and blastocoele abnormalities. Mice homozygous for a second null allele show embryonic lethality between somite formation and embryo turning with abnormal visceral endoderm. [provided by MGI curators]

Allele List at MGI

All alleles(16) : Gene trapped(16)

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap2	T	C	4: 57,886,329		probably null	Het
Alx1	T	C	10: 103,028,389	D73G	probably benign	Het
Asah1	G	A	8: 41,348,122	H156Y	probably damaging	Het
Cgn	G	A	3: 94,774,953	L439F	possibly damaging	Het
Creb1	C	A	1: 64,558,528	T7K	probably benign	Het
Cyp2c54	T	A	19: 40,038,305	I469L	probably benign	Het
Cyp2s1	T	A	7: 25,809,310	T236S	probably benign	Het
Duox1	T	C	2: 122,344,768	I1349T	probably benign	Het
Efhd2	C	T	4: 141,874,762	A36T	probably benign	Het
Espl1	G	A	15: 102,302,753		probably benign	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fat3	T	A	9: 16,246,750	Q1188L	probably damaging	Het
Flt1	A	T	5: 147,678,147	Y330N	probably damaging	Het
Golga4	A	T	9: 118,532,559	S202C	probably damaging	Het
Htr2b	C	T	1: 86,102,572	D134N	probably damaging	Het
Katna1	T	A	10: 7,752,810	C268S	probably damaging	Het
Lama4	T	C	10: 39,072,811	Y857H	probably damaging	Het
Lyst	T	C	13: 13,776,082	I3741T	probably benign	Het
Mcm4	T	C	16: 15,634,571	I233V	probably damaging	Het
Mettl22	T	C	16: 8,485,928	V286A	possibly damaging	Het
Nav3	C	A	10: 109,692,123	G1503V	noncoding transcript	Het
Obox1	T	A	7: 15,556,228	N165K	probably damaging	Het
Olfr744	T	A	14: 50,618,411	M63K	probably damaging	Het
Oxa1l	T	A	14: 54,363,301	I77N	possibly damaging	Het
Papss2	T	C	19: 32,638,360	L164P	probably damaging	Het
Polr2a	G	A	11: 69,748,056	R51C	probably damaging	Het
Rsph10b	C	G	5: 143,966,505	T606S	possibly damaging	Het
Siglecg	T	C	7: 43,412,468	V546A	probably benign	Het
Slc22a29	T	C	19: 8,169,317	S374G	probably benign	Het
Tia1	C	T	6: 86,427,736	Q318*	probably null	Het
Trpm2	T	A	10: 77,966,025	K69*	probably null	Het
Unc80	C	T	1: 66,640,614	R2115*	probably null	Het
Usp35	A	G	7: 97,314,819	S436P	probably damaging	Het
Vmn1r220	A	T	13: 23,184,313	L71*	probably null	Het
Vmn2r15	A	T	5: 109,286,284	D851E	probably benign	Het
Vps33a	A	T	5: 123,569,459	D148E	probably damaging	Het
Zfp729a	G	A	13: 67,620,104	H669Y	probably benign	Het
Zfp804b	C	T	5: 6,772,289	R258Q	probably benign	Het

Other mutations in Pikfyve

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Pikfyve	APN	1	65260121	critical splice donor site	probably null
IGL01135:Pikfyve	APN	1	65251635	missense	probably damaging	0.96
IGL01511:Pikfyve	APN	1	65258869	nonsense	probably null
IGL01759:Pikfyve	APN	1	65253353	missense	probably benign	0.06
IGL01888:Pikfyve	APN	1	65223640	missense	probably damaging	1.00
IGL01967:Pikfyve	APN	1	65264365	missense	possibly damaging	0.89
IGL02055:Pikfyve	APN	1	65238544	critical splice donor site	probably null
IGL02119:Pikfyve	APN	1	65272571	missense	probably damaging	1.00
IGL02141:Pikfyve	APN	1	65246397	missense	probably benign	0.13
IGL02207:Pikfyve	APN	1	65251678	critical splice donor site	probably null
IGL02380:Pikfyve	APN	1	65256021	missense	probably damaging	0.99
IGL02400:Pikfyve	APN	1	65252569	missense	probably damaging	1.00
IGL02403:Pikfyve	APN	1	65244504	missense	probably damaging	0.99
IGL02426:Pikfyve	APN	1	65251612	missense	possibly damaging	0.77
IGL02496:Pikfyve	APN	1	65264376	missense	possibly damaging	0.94
IGL02573:Pikfyve	APN	1	65230855	critical splice donor site	probably null
IGL02746:Pikfyve	APN	1	65234272	missense	probably damaging	1.00
IGL02814:Pikfyve	APN	1	65250194	nonsense	probably null
IGL02890:Pikfyve	APN	1	65230797	missense	probably benign	0.00
IGL03102:Pikfyve	APN	1	65252467	nonsense	probably null
IGL03294:Pikfyve	APN	1	65247067	missense	probably damaging	1.00
falcon	UTSW	1	65196741	missense	probably damaging	1.00
oompa	UTSW	1	65196706	missense	probably damaging	1.00
wonka	UTSW	1	65196706	missense	probably damaging	1.00
G5538:Pikfyve	UTSW	1	65202916	missense	probably damaging	1.00
R0031:Pikfyve	UTSW	1	65215929	splice site	probably benign
R0196:Pikfyve	UTSW	1	65256072	missense	possibly damaging	0.92
R0212:Pikfyve	UTSW	1	65262905	missense	probably benign	0.41
R0319:Pikfyve	UTSW	1	65246331	missense	probably benign	0.01
R0332:Pikfyve	UTSW	1	65264399	missense	probably benign	0.02
R0389:Pikfyve	UTSW	1	65196706	missense	probably damaging	1.00
R0443:Pikfyve	UTSW	1	65196706	missense	probably damaging	1.00
R0503:Pikfyve	UTSW	1	65219899	missense	probably damaging	0.97
R0722:Pikfyve	UTSW	1	65253523	missense	probably damaging	0.99
R0906:Pikfyve	UTSW	1	65253397	missense	probably damaging	1.00
R0907:Pikfyve	UTSW	1	65202830	missense	possibly damaging	0.64
R0970:Pikfyve	UTSW	1	65265824	missense	probably damaging	0.99
R1188:Pikfyve	UTSW	1	65246959	missense	possibly damaging	0.46
R1412:Pikfyve	UTSW	1	65202830	missense	possibly damaging	0.64
R1421:Pikfyve	UTSW	1	65271311	missense	probably damaging	1.00
R1468:Pikfyve	UTSW	1	65251666	missense	probably damaging	0.98
R1468:Pikfyve	UTSW	1	65251666	missense	probably damaging	0.98
R1472:Pikfyve	UTSW	1	65224201	missense	probably damaging	0.96
R1478:Pikfyve	UTSW	1	65262977	critical splice donor site	probably null
R1501:Pikfyve	UTSW	1	65265284	missense	possibly damaging	0.84
R1757:Pikfyve	UTSW	1	65252548	missense	probably damaging	0.99
R1773:Pikfyve	UTSW	1	65192271	missense	probably damaging	0.99
R1773:Pikfyve	UTSW	1	65246370	missense	probably benign
R1795:Pikfyve	UTSW	1	65252557	missense	probably damaging	1.00
R1855:Pikfyve	UTSW	1	65258798	missense	probably benign	0.03
R1905:Pikfyve	UTSW	1	65192295	critical splice donor site	probably null
R1995:Pikfyve	UTSW	1	65246708	missense	probably damaging	1.00
R2034:Pikfyve	UTSW	1	65222357	missense	probably damaging	1.00
R2045:Pikfyve	UTSW	1	65253353	missense	probably benign	0.06
R2229:Pikfyve	UTSW	1	65267855	missense	probably damaging	1.00
R2295:Pikfyve	UTSW	1	65246676	missense	probably damaging	0.99
R2913:Pikfyve	UTSW	1	65253517	missense	probably damaging	1.00
R3818:Pikfyve	UTSW	1	65245758	missense	probably damaging	1.00
R3832:Pikfyve	UTSW	1	65244420	missense	probably damaging	0.99
R3850:Pikfyve	UTSW	1	65230845	missense	probably damaging	1.00
R3946:Pikfyve	UTSW	1	65196681	missense	probably damaging	1.00
R4105:Pikfyve	UTSW	1	65190520	unclassified	probably benign
R4542:Pikfyve	UTSW	1	65244430	missense	probably damaging	1.00
R4574:Pikfyve	UTSW	1	65192192	missense	probably damaging	1.00
R4601:Pikfyve	UTSW	1	65234262	missense	probably damaging	1.00
R4667:Pikfyve	UTSW	1	65250273	missense	probably damaging	1.00
R4668:Pikfyve	UTSW	1	65250273	missense	probably damaging	1.00
R4669:Pikfyve	UTSW	1	65250273	missense	probably damaging	1.00
R4707:Pikfyve	UTSW	1	65267846	missense	probably benign
R4716:Pikfyve	UTSW	1	65246476	missense	possibly damaging	0.84
R4758:Pikfyve	UTSW	1	65272515	missense	possibly damaging	0.84
R4784:Pikfyve	UTSW	1	65267846	missense	probably benign
R4785:Pikfyve	UTSW	1	65267846	missense	probably benign
R4805:Pikfyve	UTSW	1	65268800	missense	probably damaging	0.99
R4831:Pikfyve	UTSW	1	65196741	missense	probably damaging	1.00
R4837:Pikfyve	UTSW	1	65246590	missense	possibly damaging	0.92
R5064:Pikfyve	UTSW	1	65253407	missense	probably damaging	1.00
R5115:Pikfyve	UTSW	1	65224117	intron	probably benign
R5265:Pikfyve	UTSW	1	65267829	missense	possibly damaging	0.72
R5279:Pikfyve	UTSW	1	65196699	nonsense	probably null
R5384:Pikfyve	UTSW	1	65244409	missense	probably damaging	1.00
R5387:Pikfyve	UTSW	1	65265268	missense	possibly damaging	0.94
R5461:Pikfyve	UTSW	1	65235033	missense	probably damaging	1.00
R5467:Pikfyve	UTSW	1	65252495	missense	probably damaging	1.00
R5560:Pikfyve	UTSW	1	65253407	missense	probably damaging	1.00
R5575:Pikfyve	UTSW	1	65273730	missense	probably damaging	1.00
R5611:Pikfyve	UTSW	1	65256088	missense	probably damaging	0.96
R5663:Pikfyve	UTSW	1	65216028	missense	probably benign	0.09
R5891:Pikfyve	UTSW	1	65202737	missense	probably damaging	1.00
R5960:Pikfyve	UTSW	1	65253438	nonsense	probably null
R6026:Pikfyve	UTSW	1	65272697	missense	probably damaging	1.00
R6057:Pikfyve	UTSW	1	65272571	missense	probably damaging	1.00
R6101:Pikfyve	UTSW	1	65264345	critical splice acceptor site	probably null
R6105:Pikfyve	UTSW	1	65264345	critical splice acceptor site	probably null
R6161:Pikfyve	UTSW	1	65216043	missense	probably benign	0.36
R6287:Pikfyve	UTSW	1	65253532	critical splice donor site	probably null
R6290:Pikfyve	UTSW	1	65202925	critical splice donor site	probably null
R6296:Pikfyve	UTSW	1	65262953	missense	probably damaging	0.99
R6516:Pikfyve	UTSW	1	65265781	missense	probably benign	0.35
R6835:Pikfyve	UTSW	1	65258843	missense	probably damaging	0.98
R6994:Pikfyve	UTSW	1	65252530	missense	probably damaging	1.00
R6997:Pikfyve	UTSW	1	65246663	missense	probably damaging	1.00
R7038:Pikfyve	UTSW	1	65234361	missense	probably damaging	1.00
R7044:Pikfyve	UTSW	1	65246854	missense	probably benign	0.01
R7057:Pikfyve	UTSW	1	65247205	missense	probably benign	0.00
R7525:Pikfyve	UTSW	1	65244426	nonsense	probably null
R7558:Pikfyve	UTSW	1	65272623	missense	probably benign	0.01
R7625:Pikfyve	UTSW	1	65267877	missense	possibly damaging	0.86
R7807:Pikfyve	UTSW	1	65269942	missense	probably damaging	1.00
R7961:Pikfyve	UTSW	1	65255134	missense	probably damaging	1.00
R8009:Pikfyve	UTSW	1	65255134	missense	probably damaging	1.00
R8154:Pikfyve	UTSW	1	65265789	missense	probably damaging	1.00
R8192:Pikfyve	UTSW	1	65246395	missense	possibly damaging	0.93
R8307:Pikfyve	UTSW	1	65245735	missense	possibly damaging	0.77
R8710:Pikfyve	UTSW	1	65215996	missense	possibly damaging	0.94
R8867:Pikfyve	UTSW	1	65244417	missense	probably damaging	1.00
R8936:Pikfyve	UTSW	1	65271268	missense	possibly damaging	0.84
R8940:Pikfyve	UTSW	1	65246970	missense	probably benign	0.00
R8995:Pikfyve	UTSW	1	65205587	critical splice acceptor site	probably null
R9092:Pikfyve	UTSW	1	65244400	missense	probably damaging	1.00
R9131:Pikfyve	UTSW	1	65246080	missense	probably damaging	1.00
R9151:Pikfyve	UTSW	1	65196739	missense	probably damaging	1.00
R9210:Pikfyve	UTSW	1	65252560	missense	probably damaging	1.00
R9212:Pikfyve	UTSW	1	65252560	missense	probably damaging	1.00
R9235:Pikfyve	UTSW	1	65260029	missense	probably benign	0.37
R9368:Pikfyve	UTSW	1	65268742	missense	probably damaging	1.00
R9489:Pikfyve	UTSW	1	65264402	missense	probably benign
R9605:Pikfyve	UTSW	1	65264402	missense	probably benign
R9686:Pikfyve	UTSW	1	65252456	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGGGTTCAATCCATCTTAGGAG -3'
(R):5'- GATAATACACACGATCCTTTTGCC -3'

Sequencing Primer
(F):5'- GTTCAATCCATCTTAGGAGAAATAGC -3'
(R):5'- GCCTTCTTACCTGAAAGATGCCAC -3'

Posted On

2020-12-14