Incidental Mutation 'R8316:Fibcd1'
ID656534
Institutional Source Beutler Lab
Gene Symbol Fibcd1
Ensembl Gene ENSMUSG00000026841
Gene Namefibrinogen C domain containing 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R8316 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location31813290-31846005 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 31833779 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028188]
Predicted Effect probably benign
Transcript: ENSMUST00000028188
SMART Domains Protein: ENSMUSP00000028188
Gene: ENSMUSG00000026841

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
low complexity region 164 178 N/A INTRINSIC
Blast:FBG 196 236 8e-14 BLAST
FBG 237 455 1.21e-117 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] FIBCD1 is a conserved type II transmembrane endocytic receptor that binds chitin and is located primarily in the intestinal brush border (Schlosser et al., 2009 [PubMed 19710473]).[supplied by OMIM, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik A C 10: 79,067,739 C248G probably damaging Het
4933427D14Rik A T 11: 72,168,786 V693E possibly damaging Het
Abcc10 G T 17: 46,327,809 L42I probably damaging Het
Alb A G 5: 90,468,590 E318G probably benign Het
Aox4 T A 1: 58,254,311 C941S possibly damaging Het
Aqp9 A G 9: 71,138,213 V38A probably benign Het
AW209491 A G 13: 14,637,764 T401A probably damaging Het
Ccdc173 A G 2: 69,781,943 probably null Het
Ccdc57 C T 11: 120,885,916 A553T probably damaging Het
Celf2 C T 2: 6,547,103 D522N probably benign Het
Cmpk2 A G 12: 26,474,137 N311S probably damaging Het
Dcn T C 10: 97,495,077 I91T probably damaging Het
Defa30 G A 8: 21,134,693 V11I probably benign Het
Dnmt3a T A 12: 3,896,965 V397E probably benign Het
Ehhadh G A 16: 21,766,303 A276V probably benign Het
Fam150b G T 12: 30,884,851 G23V probably damaging Het
Gm8909 A G 17: 36,168,262 S32P unknown Het
Gpr156 A G 16: 37,997,974 D344G probably null Het
Invs G T 4: 48,426,199 R995S possibly damaging Het
Itpr3 T C 17: 27,106,225 M1264T possibly damaging Het
Lzic C T 4: 149,488,070 A39V probably benign Het
March6 A G 15: 31,482,504 L516P possibly damaging Het
Mecom C T 3: 29,957,380 E591K probably benign Het
Mical3 T C 6: 120,934,983 D1916G probably damaging Het
Mms22l T C 4: 24,578,855 I738T probably damaging Het
Mroh2b G A 15: 4,951,264 W1438* probably null Het
Mroh8 G T 2: 157,229,959 T542K possibly damaging Het
Msl1 A T 11: 98,800,248 K416I probably damaging Het
Myh15 C A 16: 49,120,018 T777N probably damaging Het
Olfr467 G T 7: 107,814,823 V82F possibly damaging Het
Olfr482 A G 7: 108,095,243 F109S probably benign Het
Olfr642 A T 7: 104,049,622 V244E probably damaging Het
Olfr814 A G 10: 129,874,022 V245A probably damaging Het
Pdzk1ip1 T A 4: 115,089,126 V61D probably benign Het
Plcxd1 A T 5: 110,102,314 M212L probably benign Het
Pld1 A G 3: 28,024,212 T7A probably benign Het
Ppm1n T C 7: 19,278,377 D310G probably damaging Het
Prpf8 A G 11: 75,499,815 N1264S possibly damaging Het
Pum2 T A 12: 8,713,456 N204K possibly damaging Het
Recql5 G A 11: 115,894,035 T822I possibly damaging Het
Rfc1 T C 5: 65,278,734 T656A probably benign Het
Sacs T C 14: 61,189,619 Y159H possibly damaging Het
Sept14 A G 5: 129,696,130 S148P probably damaging Het
Slco1c1 T A 6: 141,546,914 M341K probably benign Het
Smok2a T C 17: 13,226,273 S246P probably damaging Het
Spata9 C A 13: 75,977,771 S124R possibly damaging Het
Sri A G 5: 8,063,317 N103D probably damaging Het
Sspo G A 6: 48,482,688 C3327Y probably damaging Het
Trank1 A G 9: 111,349,302 M353V probably benign Het
Trim80 A T 11: 115,441,180 E66V probably damaging Het
Txndc16 A G 14: 45,211,184 L73P probably damaging Het
Ugt2b34 T A 5: 86,891,390 M471L probably damaging Het
Ush2a G T 1: 188,446,702 V1357L probably benign Het
Usp15 G T 10: 123,123,943 P855T Het
Uspl1 C T 5: 149,198,681 T290I possibly damaging Het
Zbtb2 A C 10: 4,369,084 M314R probably benign Het
Zcchc2 A G 1: 106,032,114 Y1151C probably damaging Het
Zmat3 T C 3: 32,341,521 Y279C probably damaging Het
Other mutations in Fibcd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Fibcd1 APN 2 31833874 missense possibly damaging 0.67
IGL01069:Fibcd1 APN 2 31821519 missense probably benign 0.37
IGL01606:Fibcd1 APN 2 31833853 missense probably benign 0.21
IGL02345:Fibcd1 APN 2 31816592 missense probably damaging 1.00
IGL02639:Fibcd1 APN 2 31817150 missense probably damaging 0.99
IGL02682:Fibcd1 APN 2 31838564 missense probably damaging 0.99
R0006:Fibcd1 UTSW 2 31838587 missense probably damaging 1.00
R1848:Fibcd1 UTSW 2 31821549 missense probably damaging 1.00
R1969:Fibcd1 UTSW 2 31816661 missense probably damaging 1.00
R2397:Fibcd1 UTSW 2 31834423 missense probably benign 0.37
R2877:Fibcd1 UTSW 2 31838666 missense probably benign 0.12
R2878:Fibcd1 UTSW 2 31838666 missense probably benign 0.12
R2940:Fibcd1 UTSW 2 31817264 missense probably damaging 1.00
R4518:Fibcd1 UTSW 2 31817195 missense probably damaging 1.00
R5272:Fibcd1 UTSW 2 31816623 missense probably damaging 1.00
R5272:Fibcd1 UTSW 2 31816624 missense probably damaging 1.00
R5594:Fibcd1 UTSW 2 31838617 missense probably damaging 1.00
R7263:Fibcd1 UTSW 2 31817210 missense probably damaging 1.00
R7686:Fibcd1 UTSW 2 31833868 missense probably damaging 0.99
R8536:Fibcd1 UTSW 2 31816631 missense probably damaging 0.98
Z1176:Fibcd1 UTSW 2 31838539 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TGTGCCTACCTACGTTGGACAG -3'
(R):5'- GAGACTGTCACCCTGATGTG -3'

Sequencing Primer
(F):5'- TGCCTACCTACGTTGGACAGATAAAG -3'
(R):5'- TGGCTCCTTGTCACAGGC -3'
Posted On2020-12-14