Mutagenetix > Incidental Mutation

Incidental Mutation 'R8402:Vmn2r3'

656540

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r3

Ensembl Gene

ENSMUSG00000091572

Gene Name

vomeronasal 2, receptor 3

Synonyms

EG637004

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8402 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

64258961-64287495 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 64271196 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000134891 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170244] [ENSMUST00000176328]

AlphaFold

H3BJ88

Predicted Effect

probably benign
Transcript: ENSMUST00000170244

SMART Domains

Protein: ENSMUSP00000126165
Gene: ENSMUSG00000091572

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	64	479	4e-64	PFAM
Pfam:NCD3G	521	574	1.1e-17	PFAM
Pfam:7tm_3	605	842	2.9e-75	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000176328

SMART Domains

Protein: ENSMUSP00000134891
Gene: ENSMUSG00000091572

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:ANF_receptor	92	507	9.5e-66	PFAM
Pfam:NCD3G	549	602	8.8e-17	PFAM
Pfam:7tm_3	635	869	8.5e-48	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

100% (36/36)

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4922502D21Rik	T	A	6: 129,323,044	D157V	possibly damaging	Het
Adamts12	A	T	15: 11,263,290	K579N	probably damaging	Het
Adcy7	T	C	8: 88,308,735	V89A	probably benign	Het
Anapc1	G	A	2: 128,630,228	S1458L	probably benign	Het
AW551984	T	C	9: 39,597,653	Y325C	probably damaging	Het
Btnl4	T	C	17: 34,469,493	Y437C	probably damaging	Het
Ccdc88a	T	A	11: 29,463,879	S806T	probably damaging	Het
Ddit4l	A	G	3: 137,626,127	T85A	probably damaging	Het
Dmxl1	G	A	18: 49,878,326	W1183*	probably null	Het
Dmxl1	G	C	18: 49,878,327	D1184H	probably benign	Het
Dmxl1	G	T	18: 49,878,342	V1189L	probably benign	Het
Evpl	T	C	11: 116,225,371	D820G	probably benign	Het
Fam76b	T	C	9: 13,839,676	S289P	probably damaging	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Gabrb2	T	C	11: 42,487,304	W116R	probably damaging	Het
Galnt7	G	A	8: 57,542,919	A355V	probably damaging	Het
Klk1b5	T	G	7: 44,218,538	F45V	probably benign	Het
Nav2	T	C	7: 49,453,437	V661A	probably benign	Het
Nfkbiz	T	C	16: 55,816,387	N517S	probably damaging	Het
Olfr1330	A	G	4: 118,893,519	I145M	probably benign	Het
Olfr975	T	A	9: 39,950,417	Y118F	probably benign	Het
P2rx1	T	C	11: 73,013,889	F368L	probably damaging	Het
Palld	A	T	8: 61,711,406	V417E	probably damaging	Het
Robo1	C	A	16: 73,024,497	A1375E	probably benign	Het
Rps24	G	T	14: 24,490,761		probably benign	Het
Serpind1	A	G	16: 17,337,085	N259D	probably benign	Het
Sh3bp4	C	A	1: 89,145,315	N628K	probably benign	Het
Tada3	A	T	6: 113,374,813	L177Q	probably damaging	Het
Tcam1	T	A	11: 106,286,905	L508Q	probably damaging	Het
Thbs1	T	C	2: 118,115,878	S360P	possibly damaging	Het
Tmem33	T	C	5: 67,267,375		probably benign	Het
Vwa3b	A	G	1: 37,165,798	E121G	probably damaging	Het
Zfp607b	T	A	7: 27,702,702	H194Q	probably damaging	Het
Zfp729b	G	A	13: 67,592,577	P523L	probably damaging	Het

Other mutations in Vmn2r3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01019:Vmn2r3	APN	3	64259883	missense	probably damaging	1.00
IGL01468:Vmn2r3	APN	3	64274961	missense	possibly damaging	0.57
IGL02032:Vmn2r3	APN	3	64275055	missense	possibly damaging	0.95
IGL02405:Vmn2r3	APN	3	64271199	splice site	probably benign
IGL02640:Vmn2r3	APN	3	64287395	missense	probably benign
IGL02719:Vmn2r3	APN	3	64275610	missense	probably damaging	1.00
IGL02746:Vmn2r3	APN	3	64259818	missense	possibly damaging	0.74
IGL02952:Vmn2r3	APN	3	64278835	missense	probably damaging	1.00
IGL03390:Vmn2r3	APN	3	64275346	missense	possibly damaging	0.55
G1citation:Vmn2r3	UTSW	3	64287455	missense	probably benign	0.30
R0023:Vmn2r3	UTSW	3	64275366	missense	probably damaging	0.99
R0433:Vmn2r3	UTSW	3	64275633	missense	possibly damaging	0.51
R0647:Vmn2r3	UTSW	3	64275625	missense	probably damaging	1.00
R1071:Vmn2r3	UTSW	3	64275276	missense	possibly damaging	0.79
R1536:Vmn2r3	UTSW	3	64275117	missense	probably damaging	1.00
R1806:Vmn2r3	UTSW	3	64275472	missense	probably benign	0.03
R1806:Vmn2r3	UTSW	3	64287389	missense	possibly damaging	0.73
R1852:Vmn2r3	UTSW	3	64259394	missense	probably damaging	1.00
R1868:Vmn2r3	UTSW	3	64259116	missense	probably damaging	1.00
R2072:Vmn2r3	UTSW	3	64275072	missense	possibly damaging	0.87
R2240:Vmn2r3	UTSW	3	64259062	missense	probably benign	0.44
R2446:Vmn2r3	UTSW	3	64275312	missense	probably damaging	0.98
R4133:Vmn2r3	UTSW	3	64275717	missense	probably damaging	0.99
R4159:Vmn2r3	UTSW	3	64287429	nonsense	probably null
R4494:Vmn2r3	UTSW	3	64275271	missense	probably damaging	1.00
R4860:Vmn2r3	UTSW	3	64275601	missense	probably benign	0.00
R4895:Vmn2r3	UTSW	3	64259761	missense	probably benign	0.00
R4912:Vmn2r3	UTSW	3	64259197	missense	probably damaging	1.00
R5018:Vmn2r3	UTSW	3	64271353	missense	probably benign
R5033:Vmn2r3	UTSW	3	64259799	missense	probably benign	0.09
R5126:Vmn2r3	UTSW	3	64259319	missense	probably damaging	1.00
R5148:Vmn2r3	UTSW	3	64278826	missense	probably damaging	1.00
R5414:Vmn2r3	UTSW	3	64259557	nonsense	probably null
R5785:Vmn2r3	UTSW	3	64259023	missense	possibly damaging	0.89
R5905:Vmn2r3	UTSW	3	64275277	missense	probably benign	0.19
R5992:Vmn2r3	UTSW	3	64259647	missense	probably damaging	1.00
R6028:Vmn2r3	UTSW	3	64275277	missense	probably benign	0.19
R6331:Vmn2r3	UTSW	3	64278761	missense	probably damaging	1.00
R6378:Vmn2r3	UTSW	3	64275096	missense	probably damaging	1.00
R6775:Vmn2r3	UTSW	3	64275618	missense	possibly damaging	0.88
R6822:Vmn2r3	UTSW	3	64287455	missense	probably benign	0.30
R6826:Vmn2r3	UTSW	3	64274906	nonsense	probably null
R6886:Vmn2r3	UTSW	3	64259506	missense	probably damaging	1.00
R6971:Vmn2r3	UTSW	3	64259247	missense	probably damaging	0.99
R7154:Vmn2r3	UTSW	3	64287311	missense	probably benign	0.02
R7192:Vmn2r3	UTSW	3	64259943	missense	probably benign	0.24
R7282:Vmn2r3	UTSW	3	64261404	missense	possibly damaging	0.90
R7472:Vmn2r3	UTSW	3	64275532	missense	probably benign	0.00
R7563:Vmn2r3	UTSW	3	64275349	missense	possibly damaging	0.60
R7726:Vmn2r3	UTSW	3	64275518	nonsense	probably null
R7966:Vmn2r3	UTSW	3	64278814	missense	probably damaging	0.99
R8025:Vmn2r3	UTSW	3	64275450	missense	possibly damaging	0.91
R8050:Vmn2r3	UTSW	3	64271293	missense	probably damaging	0.99
R8300:Vmn2r3	UTSW	3	64274926	missense	probably benign	0.00
R8486:Vmn2r3	UTSW	3	64278949	missense	probably damaging	1.00
R8523:Vmn2r3	UTSW	3	64274890	missense	probably benign	0.03
R8678:Vmn2r3	UTSW	3	64259475	missense	possibly damaging	0.76
R8885:Vmn2r3	UTSW	3	64274962	missense	probably benign	0.00
R8886:Vmn2r3	UTSW	3	64287471	missense	possibly damaging	0.47
R8905:Vmn2r3	UTSW	3	64259274	missense	probably damaging	0.99
R8937:Vmn2r3	UTSW	3	64259252	missense	probably damaging	1.00
R8955:Vmn2r3	UTSW	3	64261382	missense	possibly damaging	0.56
R9172:Vmn2r3	UTSW	3	64278982	missense	possibly damaging	0.79
R9485:Vmn2r3	UTSW	3	64275625	missense	probably damaging	1.00
R9575:Vmn2r3	UTSW	3	64271314	missense	probably benign	0.01
R9618:Vmn2r3	UTSW	3	64271303	missense	probably damaging	0.98
X0022:Vmn2r3	UTSW	3	64271248	missense	possibly damaging	0.62
X0022:Vmn2r3	UTSW	3	64274968	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAAGAAACATGCTGTTGAGATGT -3'
(R):5'- TGCCCATCTTTACTAGCTATTTGAA -3'

Sequencing Primer
(F):5'- GTAACCGTTTTTGTTTCAGAA -3'
(R):5'- AAATAGAGCTTAATGTTCATGGAGAC -3'

Posted On

2020-12-16