Incidental Mutation 'R8402:Tmem33'
ID 656541
Institutional Source Beutler Lab
Gene Symbol Tmem33
Ensembl Gene ENSMUSG00000037720
Gene Name transmembrane protein 33
Synonyms 2700052H22Rik, 5430406L04Rik, 1110006G02Rik, 1600019D15Rik, 2410089A21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock # R8402 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 67260565-67291461 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 67267375 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144531 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037918] [ENSMUST00000160352] [ENSMUST00000161233] [ENSMUST00000161369] [ENSMUST00000162074] [ENSMUST00000162543] [ENSMUST00000201979]
AlphaFold Q9CR67
Predicted Effect probably benign
Transcript: ENSMUST00000037918
SMART Domains Protein: ENSMUSP00000042852
Gene: ENSMUSG00000037720

DomainStartEndE-ValueType
Pfam:UPF0121 1 247 9.8e-126 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160352
SMART Domains Protein: ENSMUSP00000124766
Gene: ENSMUSG00000037720

DomainStartEndE-ValueType
Pfam:UPF0121 1 246 2.8e-126 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161233
Predicted Effect probably benign
Transcript: ENSMUST00000161369
SMART Domains Protein: ENSMUSP00000124390
Gene: ENSMUSG00000037720

DomainStartEndE-ValueType
Pfam:UPF0121 7 245 1.8e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162074
Predicted Effect probably benign
Transcript: ENSMUST00000162543
SMART Domains Protein: ENSMUSP00000124765
Gene: ENSMUSG00000037720

DomainStartEndE-ValueType
Pfam:UPF0121 1 119 2.1e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201979
SMART Domains Protein: ENSMUSP00000144531
Gene: ENSMUSG00000037720

DomainStartEndE-ValueType
Pfam:UPF0121 7 61 5.9e-7 PFAM
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik T A 6: 129,323,044 D157V possibly damaging Het
Adamts12 A T 15: 11,263,290 K579N probably damaging Het
Adcy7 T C 8: 88,308,735 V89A probably benign Het
Anapc1 G A 2: 128,630,228 S1458L probably benign Het
AW551984 T C 9: 39,597,653 Y325C probably damaging Het
Btnl4 T C 17: 34,469,493 Y437C probably damaging Het
Ccdc88a T A 11: 29,463,879 S806T probably damaging Het
Ddit4l A G 3: 137,626,127 T85A probably damaging Het
Dmxl1 G A 18: 49,878,326 W1183* probably null Het
Dmxl1 G C 18: 49,878,327 D1184H probably benign Het
Dmxl1 G T 18: 49,878,342 V1189L probably benign Het
Evpl T C 11: 116,225,371 D820G probably benign Het
Fam76b T C 9: 13,839,676 S289P probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Gabrb2 T C 11: 42,487,304 W116R probably damaging Het
Galnt7 G A 8: 57,542,919 A355V probably damaging Het
Klk1b5 T G 7: 44,218,538 F45V probably benign Het
Nav2 T C 7: 49,453,437 V661A probably benign Het
Nfkbiz T C 16: 55,816,387 N517S probably damaging Het
Olfr1330 A G 4: 118,893,519 I145M probably benign Het
Olfr975 T A 9: 39,950,417 Y118F probably benign Het
P2rx1 T C 11: 73,013,889 F368L probably damaging Het
Palld A T 8: 61,711,406 V417E probably damaging Het
Robo1 C A 16: 73,024,497 A1375E probably benign Het
Rps24 G T 14: 24,490,761 probably benign Het
Serpind1 A G 16: 17,337,085 N259D probably benign Het
Sh3bp4 C A 1: 89,145,315 N628K probably benign Het
Tada3 A T 6: 113,374,813 L177Q probably damaging Het
Tcam1 T A 11: 106,286,905 L508Q probably damaging Het
Thbs1 T C 2: 118,115,878 S360P possibly damaging Het
Vmn2r3 A G 3: 64,271,196 probably benign Het
Vwa3b A G 1: 37,165,798 E121G probably damaging Het
Zfp607b T A 7: 27,702,702 H194Q probably damaging Het
Zfp729b G A 13: 67,592,577 P523L probably damaging Het
Other mutations in Tmem33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Tmem33 APN 5 67284195 missense probably damaging 1.00
IGL02076:Tmem33 APN 5 67286103 missense probably damaging 1.00
IGL03106:Tmem33 APN 5 67263796 missense probably damaging 1.00
commonplace UTSW 5 67264459 critical splice donor site probably null
R0573:Tmem33 UTSW 5 67264260 intron probably benign
R0839:Tmem33 UTSW 5 67264308 missense probably damaging 1.00
R1129:Tmem33 UTSW 5 67264460 splice site probably null
R1438:Tmem33 UTSW 5 67267291 splice site probably null
R1692:Tmem33 UTSW 5 67268554 missense probably null 0.57
R4513:Tmem33 UTSW 5 67286125 missense probably benign 0.02
R4763:Tmem33 UTSW 5 67286136 missense probably benign 0.22
R6298:Tmem33 UTSW 5 67268551 nonsense probably null
R6673:Tmem33 UTSW 5 67286125 missense probably benign 0.02
R6813:Tmem33 UTSW 5 67264459 critical splice donor site probably null
R7186:Tmem33 UTSW 5 67263787 missense possibly damaging 0.68
R7378:Tmem33 UTSW 5 67286133 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCAGGTGTTGCTTCAGCTCC -3'
(R):5'- GAAGATCTCTGACGCCTTATCAAAC -3'

Sequencing Primer
(F):5'- CAGCTCCTTTGCACGTAATACATAG -3'
(R):5'- ATCTCTGACGCCTTATCAAACTTAAC -3'
Posted On 2020-12-16