Incidental Mutation 'R8325:Ap3b2'
ID 656549
Institutional Source Beutler Lab
Gene Symbol Ap3b2
Ensembl Gene ENSMUSG00000062444
Gene Name adaptor-related protein complex 3, beta 2 subunit
Synonyms Naptb, beta3B
MMRRC Submission 067857-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.105) question?
Stock # R8325 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 81110147-81143673 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 81134237 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082090] [ENSMUST00000152355]
AlphaFold Q9JME5
Predicted Effect probably null
Transcript: ENSMUST00000082090
SMART Domains Protein: ENSMUSP00000080739
Gene: ENSMUSG00000062444

DomainStartEndE-ValueType
Pfam:Adaptin_N 34 590 8.2e-182 PFAM
low complexity region 689 782 N/A INTRINSIC
AP3B1_C 801 947 4.58e-75 SMART
Blast:B2 971 1080 2e-12 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000152355
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor protein complex 3 (AP-3 complex) is a heterotrimeric protein complex involved in the formation of clathrin-coated synaptic vesicles. The protein encoded by this gene represents the beta subunit of the neuron-specific AP-3 complex and was first identified as the target antigen in human paraneoplastic neurologic disorders. The encoded subunit binds clathrin and is phosphorylated by a casein kinase-like protein, which mediates synaptic vesicle coat assembly. Defects in this gene are a cause of early-onset epileptic encephalopathy. [provided by RefSeq, Feb 2017]
PHENOTYPE: Disruption does not alter pigmentation, but causes hyperactivity and tonic-clonic seizures and mice homozygous for a knock-out allele were found to have significantly reduced synaptic zinc levels throughout the brain, with the largest reduction observed in the CA1 stratum oriens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acr T C 15: 89,453,954 (GRCm39) V97A probably benign Het
Agrn C T 4: 156,258,119 (GRCm39) G1081D probably benign Het
Ang2 A G 14: 51,432,960 (GRCm39) S141P probably damaging Het
Apba2 A T 7: 64,345,730 (GRCm39) T307S probably benign Het
Cadm2 T A 16: 66,612,338 (GRCm39) N84Y possibly damaging Het
Camsap1 T C 2: 25,829,375 (GRCm39) D783G probably benign Het
Ccdc62 T C 5: 124,092,448 (GRCm39) C478R probably benign Het
Cep290 A C 10: 100,353,670 (GRCm39) H801P probably benign Het
Chfr T A 5: 110,310,629 (GRCm39) Y555* probably null Het
Cmas T C 6: 142,717,065 (GRCm39) probably null Het
Cmtm7 T C 9: 114,592,415 (GRCm39) I61V probably benign Het
Cyb5d2 A G 11: 72,669,651 (GRCm39) S236P possibly damaging Het
Dcp1b C T 6: 119,192,397 (GRCm39) Q438* probably null Het
Dgcr8 T C 16: 18,076,149 (GRCm39) Q678R probably damaging Het
Emc1 T A 4: 139,092,521 (GRCm39) M487K possibly damaging Het
Gm7361 T C 5: 26,467,154 (GRCm39) S258P probably damaging Het
Hbs1l A G 10: 21,183,548 (GRCm39) I96M probably benign Het
Ifi27l2a G A 12: 103,409,144 (GRCm39) A49V unknown Het
Igkv10-96 T C 6: 68,609,088 (GRCm39) Y69C possibly damaging Het
Igsf10 A T 3: 59,225,954 (GRCm39) V2573D probably damaging Het
Kcng3 T C 17: 83,939,007 (GRCm39) N14S possibly damaging Het
Kif20a A G 18: 34,759,975 (GRCm39) T94A possibly damaging Het
Lcp2 T A 11: 34,032,394 (GRCm39) V324E probably benign Het
Lmod3 T C 6: 97,224,379 (GRCm39) K481E probably benign Het
Met A G 6: 17,571,671 (GRCm39) E1330G probably damaging Het
Mroh1 GCCCAGGCCCC GCC 15: 76,316,415 (GRCm39) probably null Het
Mss51 T C 14: 20,534,771 (GRCm39) D333G possibly damaging Het
Nav3 A G 10: 109,541,464 (GRCm39) V1933A probably benign Het
Nbas A G 12: 13,338,796 (GRCm39) Y212C probably damaging Het
Nkapd1 T C 9: 50,521,608 (GRCm39) I104M probably benign Het
Npsr1 C T 9: 24,198,118 (GRCm39) probably benign Het
Nt5e A G 9: 88,245,615 (GRCm39) E295G probably benign Het
Or6b1 T C 6: 42,815,124 (GRCm39) F103S probably damaging Het
Or9m1b A T 2: 87,836,537 (GRCm39) L186Q probably damaging Het
Papss1 A G 3: 131,288,372 (GRCm39) T136A probably benign Het
Pcdha1 A T 18: 37,063,867 (GRCm39) D177V possibly damaging Het
Pcolce2 A T 9: 95,574,973 (GRCm39) S308C probably damaging Het
Pdhx G T 2: 102,872,597 (GRCm39) P162T probably benign Het
Plin3 C T 17: 56,593,268 (GRCm39) R98Q probably benign Het
Prr36 T C 8: 4,262,982 (GRCm39) T895A probably benign Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rnf213 A G 11: 119,321,271 (GRCm39) N1243S Het
Serpinb1b A T 13: 33,277,584 (GRCm39) K272N probably benign Het
Sez6l A T 5: 112,575,982 (GRCm39) probably null Het
Syne1 A T 10: 5,096,257 (GRCm39) M739K probably benign Het
Tbc1d9 G A 8: 83,966,667 (GRCm39) probably null Het
Trp53inp1 A G 4: 11,164,561 (GRCm39) D35G probably damaging Het
Trpc7 A G 13: 56,952,524 (GRCm39) V549A probably damaging Het
Usp18 T C 6: 121,230,769 (GRCm39) L66S probably damaging Het
Vmn1r238 C T 18: 3,122,529 (GRCm39) S295N probably benign Het
Vmn2r29 T C 7: 7,244,941 (GRCm39) D311G probably damaging Het
Vmn2r91 C A 17: 18,356,625 (GRCm39) A764D probably damaging Het
Wdfy4 T A 14: 32,689,444 (GRCm39) I3031F Het
Wdr7 A G 18: 63,911,535 (GRCm39) probably null Het
Other mutations in Ap3b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Ap3b2 APN 7 81,121,697 (GRCm39) missense probably damaging 0.98
IGL01695:Ap3b2 APN 7 81,126,687 (GRCm39) splice site probably benign
IGL01876:Ap3b2 APN 7 81,123,602 (GRCm39) splice site probably null
IGL02132:Ap3b2 APN 7 81,110,746 (GRCm39) missense unknown
IGL02227:Ap3b2 APN 7 81,123,152 (GRCm39) missense probably damaging 1.00
IGL02660:Ap3b2 APN 7 81,115,446 (GRCm39) missense probably benign 0.13
R0045:Ap3b2 UTSW 7 81,115,941 (GRCm39) missense possibly damaging 0.82
R0045:Ap3b2 UTSW 7 81,115,941 (GRCm39) missense possibly damaging 0.82
R0142:Ap3b2 UTSW 7 81,122,828 (GRCm39) missense probably damaging 0.96
R0317:Ap3b2 UTSW 7 81,113,429 (GRCm39) splice site probably null
R0568:Ap3b2 UTSW 7 81,114,377 (GRCm39) critical splice donor site probably null
R1035:Ap3b2 UTSW 7 81,113,659 (GRCm39) missense unknown
R1121:Ap3b2 UTSW 7 81,113,943 (GRCm39) missense unknown
R1160:Ap3b2 UTSW 7 81,115,917 (GRCm39) critical splice donor site probably null
R1489:Ap3b2 UTSW 7 81,113,438 (GRCm39) nonsense probably null
R1542:Ap3b2 UTSW 7 81,127,825 (GRCm39) splice site probably null
R1652:Ap3b2 UTSW 7 81,123,147 (GRCm39) missense probably damaging 1.00
R1741:Ap3b2 UTSW 7 81,117,347 (GRCm39) missense possibly damaging 0.95
R1872:Ap3b2 UTSW 7 81,113,898 (GRCm39) missense unknown
R2065:Ap3b2 UTSW 7 81,113,522 (GRCm39) missense unknown
R2353:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R2354:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R2398:Ap3b2 UTSW 7 81,126,943 (GRCm39) missense probably damaging 0.99
R3421:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R3710:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R3932:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R3933:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R4152:Ap3b2 UTSW 7 81,127,765 (GRCm39) missense probably damaging 1.00
R4209:Ap3b2 UTSW 7 81,126,884 (GRCm39) missense probably benign 0.02
R4732:Ap3b2 UTSW 7 81,121,680 (GRCm39) missense probably damaging 1.00
R4733:Ap3b2 UTSW 7 81,121,680 (GRCm39) missense probably damaging 1.00
R4841:Ap3b2 UTSW 7 81,127,678 (GRCm39) missense probably damaging 1.00
R5207:Ap3b2 UTSW 7 81,126,517 (GRCm39) missense possibly damaging 0.48
R5659:Ap3b2 UTSW 7 81,126,500 (GRCm39) missense probably damaging 0.98
R6109:Ap3b2 UTSW 7 81,143,340 (GRCm39) missense possibly damaging 0.55
R6223:Ap3b2 UTSW 7 81,123,210 (GRCm39) nonsense probably null
R6901:Ap3b2 UTSW 7 81,134,660 (GRCm39) critical splice acceptor site probably null
R6981:Ap3b2 UTSW 7 81,127,741 (GRCm39) missense probably damaging 1.00
R7061:Ap3b2 UTSW 7 81,110,757 (GRCm39) missense unknown
R7317:Ap3b2 UTSW 7 81,110,776 (GRCm39) missense unknown
R7501:Ap3b2 UTSW 7 81,123,194 (GRCm39) missense probably damaging 0.99
R7543:Ap3b2 UTSW 7 81,115,894 (GRCm39) splice site probably null
R7643:Ap3b2 UTSW 7 81,126,820 (GRCm39) missense probably benign 0.24
R7707:Ap3b2 UTSW 7 81,126,530 (GRCm39) missense possibly damaging 0.60
R8111:Ap3b2 UTSW 7 81,113,530 (GRCm39) missense unknown
R8273:Ap3b2 UTSW 7 81,112,990 (GRCm39) missense unknown
R8355:Ap3b2 UTSW 7 81,122,851 (GRCm39) missense probably damaging 1.00
R8697:Ap3b2 UTSW 7 81,122,783 (GRCm39) missense possibly damaging 0.91
R8716:Ap3b2 UTSW 7 81,126,901 (GRCm39) missense probably benign 0.03
R8923:Ap3b2 UTSW 7 81,126,931 (GRCm39) missense probably benign 0.08
R9002:Ap3b2 UTSW 7 81,117,192 (GRCm39) missense probably benign 0.02
R9163:Ap3b2 UTSW 7 81,113,546 (GRCm39) missense unknown
R9304:Ap3b2 UTSW 7 81,113,019 (GRCm39) missense unknown
R9321:Ap3b2 UTSW 7 81,114,252 (GRCm39) critical splice acceptor site probably null
R9413:Ap3b2 UTSW 7 81,127,757 (GRCm39) missense possibly damaging 0.45
R9459:Ap3b2 UTSW 7 81,123,651 (GRCm39) missense probably benign 0.16
R9746:Ap3b2 UTSW 7 81,126,092 (GRCm39) missense probably damaging 1.00
X0013:Ap3b2 UTSW 7 81,112,988 (GRCm39) critical splice donor site probably null
X0028:Ap3b2 UTSW 7 81,113,512 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGAGCCTGATCTTCCCAAC -3'
(R):5'- CCCTAAACTGGATGTGAATCGG -3'

Sequencing Primer
(F):5'- ACTTCTGCAAGTAGGCGAGGTC -3'
(R):5'- GGATTTGGGGGACACACTC -3'
Posted On 2020-12-17