Incidental Mutation 'R8325:Ap3b2'
ID656549
Institutional Source Beutler Lab
Gene Symbol Ap3b2
Ensembl Gene ENSMUSG00000062444
Gene Nameadaptor-related protein complex 3, beta 2 subunit
Synonymsbeta3B, Naptb
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R8325 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location81460399-81493925 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 81484489 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082090] [ENSMUST00000152355]
AlphaFold Q9JME5
Predicted Effect probably null
Transcript: ENSMUST00000082090
SMART Domains Protein: ENSMUSP00000080739
Gene: ENSMUSG00000062444

DomainStartEndE-ValueType
Pfam:Adaptin_N 34 590 8.2e-182 PFAM
low complexity region 689 782 N/A INTRINSIC
AP3B1_C 801 947 4.58e-75 SMART
Blast:B2 971 1080 2e-12 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000152355
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor protein complex 3 (AP-3 complex) is a heterotrimeric protein complex involved in the formation of clathrin-coated synaptic vesicles. The protein encoded by this gene represents the beta subunit of the neuron-specific AP-3 complex and was first identified as the target antigen in human paraneoplastic neurologic disorders. The encoded subunit binds clathrin and is phosphorylated by a casein kinase-like protein, which mediates synaptic vesicle coat assembly. Defects in this gene are a cause of early-onset epileptic encephalopathy. [provided by RefSeq, Feb 2017]
PHENOTYPE: Disruption does not alter pigmentation, but causes hyperactivity and tonic-clonic seizures and mice homozygous for a knock-out allele were found to have significantly reduced synaptic zinc levels throughout the brain, with the largest reduction observed in the CA1 stratum oriens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acr T C 15: 89,569,751 V97A probably benign Het
Agrn C T 4: 156,173,662 G1081D probably benign Het
Ang2 A G 14: 51,195,503 S141P probably damaging Het
Apba2 A T 7: 64,695,982 T307S probably benign Het
AU019823 T C 9: 50,610,308 I104M probably benign Het
Cadm2 T A 16: 66,815,450 N84Y possibly damaging Het
Camsap1 T C 2: 25,939,363 D783G probably benign Het
Ccdc62 T C 5: 123,954,385 C478R probably benign Het
Cep290 A C 10: 100,517,808 H801P probably benign Het
Chfr T A 5: 110,162,763 Y555* probably null Het
Cmas T C 6: 142,771,339 probably null Het
Cmtm7 T C 9: 114,763,347 I61V probably benign Het
Cyb5d2 A G 11: 72,778,825 S236P possibly damaging Het
Dcp1b C T 6: 119,215,436 Q438* probably null Het
Dgcr8 T C 16: 18,258,285 Q678R probably damaging Het
Emc1 T A 4: 139,365,210 M487K possibly damaging Het
Gm7361 T C 5: 26,262,156 S258P probably damaging Het
Hbs1l A G 10: 21,307,649 I96M probably benign Het
Ifi27l2a G A 12: 103,442,885 A49V unknown Het
Igkv10-96 T C 6: 68,632,104 Y69C possibly damaging Het
Igsf10 A T 3: 59,318,533 V2573D probably damaging Het
Kcng3 T C 17: 83,631,578 N14S possibly damaging Het
Kif20a A G 18: 34,626,922 T94A possibly damaging Het
Lcp2 T A 11: 34,082,394 V324E probably benign Het
Lmod3 T C 6: 97,247,418 K481E probably benign Het
Met A G 6: 17,571,672 E1330G probably damaging Het
Mroh1 GCCCAGGCCCC GCC 15: 76,432,215 probably null Het
Mss51 T C 14: 20,484,703 D333G possibly damaging Het
Nav3 A G 10: 109,705,603 V1933A probably benign Het
Nbas A G 12: 13,288,795 Y212C probably damaging Het
Npsr1 C T 9: 24,286,822 probably benign Het
Nt5e A G 9: 88,363,562 E295G probably benign Het
Olfr1160 A T 2: 88,006,193 L186Q probably damaging Het
Olfr449 T C 6: 42,838,190 F103S probably damaging Het
Papss1 A G 3: 131,582,611 T136A probably benign Het
Pcdha1 A T 18: 36,930,814 D177V possibly damaging Het
Pcolce2 A T 9: 95,692,920 S308C probably damaging Het
Pdhx G T 2: 103,042,252 P162T probably benign Het
Plin3 C T 17: 56,286,268 R98Q probably benign Het
Prr36 T C 8: 4,212,982 T895A probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rnf213 A G 11: 119,430,445 N1243S Het
Serpinb1b A T 13: 33,093,601 K272N probably benign Het
Sez6l A T 5: 112,428,116 probably null Het
Syne1 A T 10: 5,146,257 M739K probably benign Het
Tbc1d9 G A 8: 83,240,038 probably null Het
Trp53inp1 A G 4: 11,164,561 D35G probably damaging Het
Trpc7 A G 13: 56,804,711 V549A probably damaging Het
Usp18 T C 6: 121,253,810 L66S probably damaging Het
Vmn1r238 C T 18: 3,122,529 S295N probably benign Het
Vmn2r29 T C 7: 7,241,942 D311G probably damaging Het
Vmn2r91 C A 17: 18,136,363 A764D probably damaging Het
Wdfy4 T A 14: 32,967,487 I3031F Het
Wdr7 A G 18: 63,778,464 probably null Het
Other mutations in Ap3b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Ap3b2 APN 7 81471949 missense probably damaging 0.98
IGL01695:Ap3b2 APN 7 81476939 splice site probably benign
IGL01876:Ap3b2 APN 7 81473854 splice site probably null
IGL02132:Ap3b2 APN 7 81460998 missense unknown
IGL02227:Ap3b2 APN 7 81473404 missense probably damaging 1.00
IGL02660:Ap3b2 APN 7 81465698 missense probably benign 0.13
R0045:Ap3b2 UTSW 7 81466193 missense possibly damaging 0.82
R0045:Ap3b2 UTSW 7 81466193 missense possibly damaging 0.82
R0142:Ap3b2 UTSW 7 81473080 missense probably damaging 0.96
R0317:Ap3b2 UTSW 7 81463681 splice site probably null
R0568:Ap3b2 UTSW 7 81464629 critical splice donor site probably null
R1035:Ap3b2 UTSW 7 81463911 missense unknown
R1121:Ap3b2 UTSW 7 81464195 missense unknown
R1160:Ap3b2 UTSW 7 81466169 critical splice donor site probably null
R1489:Ap3b2 UTSW 7 81463690 nonsense probably null
R1542:Ap3b2 UTSW 7 81478077 splice site probably null
R1652:Ap3b2 UTSW 7 81473399 missense probably damaging 1.00
R1741:Ap3b2 UTSW 7 81467599 missense possibly damaging 0.95
R1872:Ap3b2 UTSW 7 81464150 missense unknown
R2065:Ap3b2 UTSW 7 81463774 missense unknown
R2353:Ap3b2 UTSW 7 81473850 unclassified probably benign
R2354:Ap3b2 UTSW 7 81473850 unclassified probably benign
R2398:Ap3b2 UTSW 7 81477195 missense probably damaging 0.99
R3421:Ap3b2 UTSW 7 81473850 unclassified probably benign
R3710:Ap3b2 UTSW 7 81473850 unclassified probably benign
R3932:Ap3b2 UTSW 7 81473850 unclassified probably benign
R3933:Ap3b2 UTSW 7 81473850 unclassified probably benign
R4152:Ap3b2 UTSW 7 81478017 missense probably damaging 1.00
R4209:Ap3b2 UTSW 7 81477136 missense probably benign 0.02
R4732:Ap3b2 UTSW 7 81471932 missense probably damaging 1.00
R4733:Ap3b2 UTSW 7 81471932 missense probably damaging 1.00
R4841:Ap3b2 UTSW 7 81477930 missense probably damaging 1.00
R5207:Ap3b2 UTSW 7 81476769 missense possibly damaging 0.48
R5659:Ap3b2 UTSW 7 81476752 missense probably damaging 0.98
R6109:Ap3b2 UTSW 7 81493592 missense possibly damaging 0.55
R6223:Ap3b2 UTSW 7 81473462 nonsense probably null
R6901:Ap3b2 UTSW 7 81484912 critical splice acceptor site probably null
R6981:Ap3b2 UTSW 7 81477993 missense probably damaging 1.00
R7061:Ap3b2 UTSW 7 81461009 missense unknown
R7317:Ap3b2 UTSW 7 81461028 missense unknown
R7501:Ap3b2 UTSW 7 81473446 missense probably damaging 0.99
R7543:Ap3b2 UTSW 7 81466146 splice site probably null
R7643:Ap3b2 UTSW 7 81477072 missense probably benign 0.24
R7707:Ap3b2 UTSW 7 81476782 missense possibly damaging 0.60
R8111:Ap3b2 UTSW 7 81463782 missense unknown
R8273:Ap3b2 UTSW 7 81463242 missense unknown
R8355:Ap3b2 UTSW 7 81473103 missense probably damaging 1.00
R8697:Ap3b2 UTSW 7 81473035 missense possibly damaging 0.91
R8716:Ap3b2 UTSW 7 81477153 missense probably benign 0.03
R8923:Ap3b2 UTSW 7 81477183 missense probably benign 0.08
R9002:Ap3b2 UTSW 7 81467444 missense probably benign 0.02
X0013:Ap3b2 UTSW 7 81463240 critical splice donor site probably null
X0028:Ap3b2 UTSW 7 81463764 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGAGCCTGATCTTCCCAAC -3'
(R):5'- CCCTAAACTGGATGTGAATCGG -3'

Sequencing Primer
(F):5'- ACTTCTGCAAGTAGGCGAGGTC -3'
(R):5'- GGATTTGGGGGACACACTC -3'
Posted On2020-12-17