Mutagenetix > Incidental Mutation

Incidental Mutation 'R8325:Ap3b2'

656549

Institutional Source

Beutler Lab

Gene Symbol

Ap3b2

Ensembl Gene

ENSMUSG00000062444

Gene Name

adaptor-related protein complex 3, beta 2 subunit

Synonyms

beta3B, Naptb

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.096) question?

Stock #

R8325 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

81460399-81493925 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 81484489 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000146497 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000082090] [ENSMUST00000152355]

AlphaFold

Q9JME5

Predicted Effect

probably null
Transcript: ENSMUST00000082090

SMART Domains

Protein: ENSMUSP00000080739
Gene: ENSMUSG00000062444

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	34	590	8.2e-182	PFAM
low complexity region	689	782	N/A	INTRINSIC
AP3B1_C	801	947	4.58e-75	SMART
Blast:B2	971	1080	2e-12	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000152355

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.2%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor protein complex 3 (AP-3 complex) is a heterotrimeric protein complex involved in the formation of clathrin-coated synaptic vesicles. The protein encoded by this gene represents the beta subunit of the neuron-specific AP-3 complex and was first identified as the target antigen in human paraneoplastic neurologic disorders. The encoded subunit binds clathrin and is phosphorylated by a casein kinase-like protein, which mediates synaptic vesicle coat assembly. Defects in this gene are a cause of early-onset epileptic encephalopathy. [provided by RefSeq, Feb 2017]
PHENOTYPE: Disruption does not alter pigmentation, but causes hyperactivity and tonic-clonic seizures and mice homozygous for a knock-out allele were found to have significantly reduced synaptic zinc levels throughout the brain, with the largest reduction observed in the CA1 stratum oriens. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acr	T	C	15: 89,569,751	V97A	probably benign	Het
Agrn	C	T	4: 156,173,662	G1081D	probably benign	Het
Ang2	A	G	14: 51,195,503	S141P	probably damaging	Het
Apba2	A	T	7: 64,695,982	T307S	probably benign	Het
AU019823	T	C	9: 50,610,308	I104M	probably benign	Het
Cadm2	T	A	16: 66,815,450	N84Y	possibly damaging	Het
Camsap1	T	C	2: 25,939,363	D783G	probably benign	Het
Ccdc62	T	C	5: 123,954,385	C478R	probably benign	Het
Cep290	A	C	10: 100,517,808	H801P	probably benign	Het
Chfr	T	A	5: 110,162,763	Y555*	probably null	Het
Cmas	T	C	6: 142,771,339		probably null	Het
Cmtm7	T	C	9: 114,763,347	I61V	probably benign	Het
Cyb5d2	A	G	11: 72,778,825	S236P	possibly damaging	Het
Dcp1b	C	T	6: 119,215,436	Q438*	probably null	Het
Dgcr8	T	C	16: 18,258,285	Q678R	probably damaging	Het
Emc1	T	A	4: 139,365,210	M487K	possibly damaging	Het
Gm7361	T	C	5: 26,262,156	S258P	probably damaging	Het
Hbs1l	A	G	10: 21,307,649	I96M	probably benign	Het
Ifi27l2a	G	A	12: 103,442,885	A49V	unknown	Het
Igkv10-96	T	C	6: 68,632,104	Y69C	possibly damaging	Het
Igsf10	A	T	3: 59,318,533	V2573D	probably damaging	Het
Kcng3	T	C	17: 83,631,578	N14S	possibly damaging	Het
Kif20a	A	G	18: 34,626,922	T94A	possibly damaging	Het
Lcp2	T	A	11: 34,082,394	V324E	probably benign	Het
Lmod3	T	C	6: 97,247,418	K481E	probably benign	Het
Met	A	G	6: 17,571,672	E1330G	probably damaging	Het
Mroh1	GCCCAGGCCCC	GCC	15: 76,432,215		probably null	Het
Mss51	T	C	14: 20,484,703	D333G	possibly damaging	Het
Nav3	A	G	10: 109,705,603	V1933A	probably benign	Het
Nbas	A	G	12: 13,288,795	Y212C	probably damaging	Het
Npsr1	C	T	9: 24,286,822		probably benign	Het
Nt5e	A	G	9: 88,363,562	E295G	probably benign	Het
Olfr1160	A	T	2: 88,006,193	L186Q	probably damaging	Het
Olfr449	T	C	6: 42,838,190	F103S	probably damaging	Het
Papss1	A	G	3: 131,582,611	T136A	probably benign	Het
Pcdha1	A	T	18: 36,930,814	D177V	possibly damaging	Het
Pcolce2	A	T	9: 95,692,920	S308C	probably damaging	Het
Pdhx	G	T	2: 103,042,252	P162T	probably benign	Het
Plin3	C	T	17: 56,286,268	R98Q	probably benign	Het
Prr36	T	C	8: 4,212,982	T895A	probably benign	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Rnf213	A	G	11: 119,430,445	N1243S		Het
Serpinb1b	A	T	13: 33,093,601	K272N	probably benign	Het
Sez6l	A	T	5: 112,428,116		probably null	Het
Syne1	A	T	10: 5,146,257	M739K	probably benign	Het
Tbc1d9	G	A	8: 83,240,038		probably null	Het
Trp53inp1	A	G	4: 11,164,561	D35G	probably damaging	Het
Trpc7	A	G	13: 56,804,711	V549A	probably damaging	Het
Usp18	T	C	6: 121,253,810	L66S	probably damaging	Het
Vmn1r238	C	T	18: 3,122,529	S295N	probably benign	Het
Vmn2r29	T	C	7: 7,241,942	D311G	probably damaging	Het
Vmn2r91	C	A	17: 18,136,363	A764D	probably damaging	Het
Wdfy4	T	A	14: 32,967,487	I3031F		Het
Wdr7	A	G	18: 63,778,464		probably null	Het

Other mutations in Ap3b2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00772:Ap3b2	APN	7	81471949	missense	probably damaging	0.98
IGL01695:Ap3b2	APN	7	81476939	splice site	probably benign
IGL01876:Ap3b2	APN	7	81473854	splice site	probably null
IGL02132:Ap3b2	APN	7	81460998	missense	unknown
IGL02227:Ap3b2	APN	7	81473404	missense	probably damaging	1.00
IGL02660:Ap3b2	APN	7	81465698	missense	probably benign	0.13
R0045:Ap3b2	UTSW	7	81466193	missense	possibly damaging	0.82
R0045:Ap3b2	UTSW	7	81466193	missense	possibly damaging	0.82
R0142:Ap3b2	UTSW	7	81473080	missense	probably damaging	0.96
R0317:Ap3b2	UTSW	7	81463681	splice site	probably null
R0568:Ap3b2	UTSW	7	81464629	critical splice donor site	probably null
R1035:Ap3b2	UTSW	7	81463911	missense	unknown
R1121:Ap3b2	UTSW	7	81464195	missense	unknown
R1160:Ap3b2	UTSW	7	81466169	critical splice donor site	probably null
R1489:Ap3b2	UTSW	7	81463690	nonsense	probably null
R1542:Ap3b2	UTSW	7	81478077	splice site	probably null
R1652:Ap3b2	UTSW	7	81473399	missense	probably damaging	1.00
R1741:Ap3b2	UTSW	7	81467599	missense	possibly damaging	0.95
R1872:Ap3b2	UTSW	7	81464150	missense	unknown
R2065:Ap3b2	UTSW	7	81463774	missense	unknown
R2353:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R2354:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R2398:Ap3b2	UTSW	7	81477195	missense	probably damaging	0.99
R3421:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R3710:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R3932:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R3933:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R4152:Ap3b2	UTSW	7	81478017	missense	probably damaging	1.00
R4209:Ap3b2	UTSW	7	81477136	missense	probably benign	0.02
R4732:Ap3b2	UTSW	7	81471932	missense	probably damaging	1.00
R4733:Ap3b2	UTSW	7	81471932	missense	probably damaging	1.00
R4841:Ap3b2	UTSW	7	81477930	missense	probably damaging	1.00
R5207:Ap3b2	UTSW	7	81476769	missense	possibly damaging	0.48
R5659:Ap3b2	UTSW	7	81476752	missense	probably damaging	0.98
R6109:Ap3b2	UTSW	7	81493592	missense	possibly damaging	0.55
R6223:Ap3b2	UTSW	7	81473462	nonsense	probably null
R6901:Ap3b2	UTSW	7	81484912	critical splice acceptor site	probably null
R6981:Ap3b2	UTSW	7	81477993	missense	probably damaging	1.00
R7061:Ap3b2	UTSW	7	81461009	missense	unknown
R7317:Ap3b2	UTSW	7	81461028	missense	unknown
R7501:Ap3b2	UTSW	7	81473446	missense	probably damaging	0.99
R7543:Ap3b2	UTSW	7	81466146	splice site	probably null
R7643:Ap3b2	UTSW	7	81477072	missense	probably benign	0.24
R7707:Ap3b2	UTSW	7	81476782	missense	possibly damaging	0.60
R8111:Ap3b2	UTSW	7	81463782	missense	unknown
R8273:Ap3b2	UTSW	7	81463242	missense	unknown
R8355:Ap3b2	UTSW	7	81473103	missense	probably damaging	1.00
R8697:Ap3b2	UTSW	7	81473035	missense	possibly damaging	0.91
R8716:Ap3b2	UTSW	7	81477153	missense	probably benign	0.03
R8923:Ap3b2	UTSW	7	81477183	missense	probably benign	0.08
R9002:Ap3b2	UTSW	7	81467444	missense	probably benign	0.02
R9163:Ap3b2	UTSW	7	81463798	missense	unknown
R9304:Ap3b2	UTSW	7	81463271	missense	unknown
R9321:Ap3b2	UTSW	7	81464504	critical splice acceptor site	probably null
R9413:Ap3b2	UTSW	7	81478009	missense	possibly damaging	0.45
R9459:Ap3b2	UTSW	7	81473903	missense	probably benign	0.16
R9746:Ap3b2	UTSW	7	81476344	missense	probably damaging	1.00
X0013:Ap3b2	UTSW	7	81463240	critical splice donor site	probably null
X0028:Ap3b2	UTSW	7	81463764	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CTGAGCCTGATCTTCCCAAC -3'
(R):5'- CCCTAAACTGGATGTGAATCGG -3'

Sequencing Primer
(F):5'- ACTTCTGCAAGTAGGCGAGGTC -3'
(R):5'- GGATTTGGGGGACACACTC -3'

Posted On

2020-12-17