Mutagenetix > Incidental Mutations

Incidental Mutation 'R8335:Xpo1'

656558

Institutional Source

Beutler Lab

Gene Symbol

Xpo1

Ensembl Gene

ENSMUSG00000020290

Gene Name

exportin 1

Synonyms

Crm1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8335 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

23256041-23298249 bp(+) (GRCm38)

Type of Mutation

splice site (101 bp from exon)

DNA Base Change (assembly)

T to G at 23280603 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000105178 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020538] [ENSMUST00000102869] [ENSMUST00000102870] [ENSMUST00000109551]

AlphaFold

Q6P5F9

PDB Structure

Crystal Structure of the Nuclear Export Complex CRM1-Snurportin1-RanGTP [X-RAY DIFFRACTION]
Crystal structure of the PKI NES-CRM1-RanGTP nuclear export complex [X-RAY DIFFRACTION]
Crystal structure of the HIV-1 Rev NES-CRM1-RanGTP nuclear export complex (crystal I) [X-RAY DIFFRACTION]
Crystal structure of the HIV-1 Rev NES-CRM1-RanGTP nuclear export complex (crystal II) [X-RAY DIFFRACTION]
Crystal structure of the CRM1-RanGTP complex [X-RAY DIFFRACTION]

Predicted Effect

probably null
Transcript: ENSMUST00000020538

SMART Domains

Protein: ENSMUSP00000020538
Gene: ENSMUSG00000020290

Domain	Start	End	E-Value	Type
IBN_N	46	112	2.3e-10	SMART
Pfam:Xpo1	123	268	1.3e-44	PFAM
Blast:IL1	407	518	9e-14	BLAST
Blast:CRM1_C	590	699	1e-22	BLAST
CRM1_C	709	1027	4.63e-211	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000102869

SMART Domains

Protein: ENSMUSP00000099933
Gene: ENSMUSG00000020290

Domain	Start	End	E-Value	Type
IBN_N	46	112	2.3e-10	SMART
Pfam:Xpo1	123	268	7.4e-44	PFAM
Blast:IL1	407	518	9e-14	BLAST
Blast:CRM1_C	590	699	1e-22	BLAST
CRM1_C	709	1027	4.63e-211	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000102870

SMART Domains

Protein: ENSMUSP00000099934
Gene: ENSMUSG00000020290

Domain	Start	End	E-Value	Type
IBN_N	46	112	2.3e-10	SMART
Pfam:Xpo1	123	268	1.3e-44	PFAM
Blast:IL1	407	518	9e-14	BLAST
Blast:CRM1_C	590	699	1e-22	BLAST
CRM1_C	709	1027	4.63e-211	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000109551

SMART Domains

Protein: ENSMUSP00000105178
Gene: ENSMUSG00000020290

Domain	Start	End	E-Value	Type
IBN_N	46	112	2.3e-10	SMART
Pfam:Xpo1	123	268	1.3e-44	PFAM
Blast:IL1	407	518	9e-14	BLAST
Blast:CRM1_C	590	699	1e-22	BLAST
CRM1_C	709	1027	4.63e-211	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000150750

SMART Domains

Protein: ENSMUSP00000117846
Gene: ENSMUSG00000020290

Domain	Start	End	E-Value	Type
Blast:CRM1_C	97	136	3e-8	BLAST
Pfam:CRM1_C	171	233	4.3e-22	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

97% (33/34)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This cell-cycle-regulated gene encodes a protein that mediates leucine-rich nuclear export signal (NES)-dependent protein transport. The protein specifically inhibits the nuclear export of Rev and U snRNAs. It is involved in the control of several cellular processes by controlling the localization of cyclin B, MPAK, and MAPKAP kinase 2. This protein also regulates NFAT and AP-1. [provided by RefSeq, Jan 2015]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ccdc47	C	G	11: 106,208,258	E202D	possibly damaging	Het
Ccdc47	T	C	11: 106,208,259	E202G	probably damaging	Het
Depdc1a	C	A	3: 159,523,222	P537Q	probably damaging	Het
Dync2h1	A	T	9: 7,084,941	M2816K	probably benign	Het
Gatb	T	C	3: 85,574,321		probably null	Het
Gm6356	A	G	14: 6,971,838	M99T	probably benign	Het
Ighv1-67	A	C	12: 115,604,124	V56G	probably damaging	Het
Il27ra	A	T	8: 84,039,501	L218Q	probably damaging	Het
Madd	G	A	2: 91,170,239	R494C	probably damaging	Het
Mfsd8	G	A	3: 40,835,193	R140C	probably damaging	Het
Mink1	C	T	11: 70,609,575	R784W	probably damaging	Het
Mttp	C	T	3: 138,103,212	D697N	possibly damaging	Het
Mug2	A	T	6: 122,040,584	M427L	probably benign	Het
Olfr1087	T	A	2: 86,690,168	D269V	probably benign	Het
Olfr1122	A	G	2: 87,387,860	I52V	probably benign	Het
Olfr1200	G	T	2: 88,767,773	P181T	probably damaging	Het
Olfr1402	T	C	3: 97,410,708	N158D	probably benign	Het
Paxip1	T	C	5: 27,766,124	H409R	unknown	Het
Pkp3	T	C	7: 141,087,756	I490T	probably damaging	Het
Plekhg4	G	T	8: 105,376,216	V236L	probably damaging	Het
Pm20d2	T	C	4: 33,189,245	S46G	probably benign	Het
Prss33	A	G	17: 23,834,595		probably null	Het
Ptpn3	A	T	4: 57,235,286	L358I	probably damaging	Het
Pxdn	A	G	12: 30,002,097	T758A	probably damaging	Het
Sall3	G	A	18: 80,969,586	R1212C	probably benign	Het
Sox6	G	A	7: 115,701,714	L173F	probably damaging	Het
Spata20	T	C	11: 94,482,543	K501E	probably benign	Het
Stat2	G	A	10: 128,276,583	V31I	possibly damaging	Het
Synpo2	T	A	3: 123,114,534	N378Y	probably damaging	Het
Tacr2	A	T	10: 62,265,167	H352L	probably benign	Het
Tmem214	A	G	5: 30,872,122	K230E	possibly damaging	Het
Tnfsf8	A	G	4: 63,834,115	S238P	probably damaging	Het
Tnn	C	T	1: 160,118,483	G922R	probably damaging	Het
Trhde	A	G	10: 114,486,704		probably null	Het
Ttc6	A	G	12: 57,660,291	I661M	probably benign	Het
Vmn1r209	T	A	13: 22,805,807	M238L	probably damaging	Het
Vmn2r29	A	G	7: 7,231,446	S814P	probably damaging	Het
Vsig10	T	C	5: 117,348,370	L448P	probably damaging	Het
Zfp616	A	T	11: 74,083,900	K423*	probably null	Het

Other mutations in Xpo1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00841:Xpo1	APN	11	23285094	missense	probably damaging	1.00
IGL01464:Xpo1	APN	11	23267703	missense	probably damaging	0.97
IGL01561:Xpo1	APN	11	23282706	missense	possibly damaging	0.76
IGL01630:Xpo1	APN	11	23285846	missense	probably benign	0.00
IGL01700:Xpo1	APN	11	23276422	splice site	probably benign
IGL02000:Xpo1	APN	11	23296003	missense	probably damaging	1.00
IGL02299:Xpo1	APN	11	23293915	splice site	probably benign
IGL02313:Xpo1	APN	11	23277065	missense	probably damaging	1.00
IGL02828:Xpo1	APN	11	23282593	missense	probably damaging	0.97
IGL03210:Xpo1	APN	11	23278834	missense	probably benign	0.01
IGL03329:Xpo1	APN	11	23284306	missense	probably benign
PIT1430001:Xpo1	UTSW	11	23276437	missense	possibly damaging	0.66
R0507:Xpo1	UTSW	11	23294682	missense	possibly damaging	0.61
R0594:Xpo1	UTSW	11	23280402	missense	probably damaging	1.00
R0706:Xpo1	UTSW	11	23280441	missense	probably benign	0.09
R0742:Xpo1	UTSW	11	23294682	missense	possibly damaging	0.61
R1385:Xpo1	UTSW	11	23261863	missense	probably damaging	0.96
R1478:Xpo1	UTSW	11	23291623	missense	probably damaging	0.99
R1483:Xpo1	UTSW	11	23284863	missense	probably benign	0.04
R1694:Xpo1	UTSW	11	23281399	missense	probably benign	0.12
R1775:Xpo1	UTSW	11	23271193	missense	probably benign
R1827:Xpo1	UTSW	11	23285155	missense	probably benign	0.00
R2262:Xpo1	UTSW	11	23284634	splice site	probably null
R2263:Xpo1	UTSW	11	23284634	splice site	probably null
R4510:Xpo1	UTSW	11	23287401	missense	possibly damaging	0.60
R4511:Xpo1	UTSW	11	23287401	missense	possibly damaging	0.60
R4840:Xpo1	UTSW	11	23278183	missense	probably damaging	1.00
R4901:Xpo1	UTSW	11	23281327	missense	possibly damaging	0.62
R5176:Xpo1	UTSW	11	23295977	missense	probably damaging	0.99
R5508:Xpo1	UTSW	11	23294645	missense	probably benign
R5927:Xpo1	UTSW	11	23268653	unclassified	probably benign
R5927:Xpo1	UTSW	11	23268656	unclassified	probably benign
R6110:Xpo1	UTSW	11	23287434	missense	probably damaging	0.99
R6421:Xpo1	UTSW	11	23291490	missense	possibly damaging	0.60
R6591:Xpo1	UTSW	11	23286875	missense	probably damaging	1.00
R6691:Xpo1	UTSW	11	23286875	missense	probably damaging	1.00
R6698:Xpo1	UTSW	11	23294040	missense	probably benign	0.01
R6958:Xpo1	UTSW	11	23285855	missense	probably benign
R7407:Xpo1	UTSW	11	23285823	missense	probably damaging	1.00
R7482:Xpo1	UTSW	11	23282544	missense	probably benign	0.00
R7624:Xpo1	UTSW	11	23282584	missense	probably damaging	0.99
R8823:Xpo1	UTSW	11	23267752	missense	probably benign
R9128:Xpo1	UTSW	11	23285058	missense	probably damaging	1.00
R9232:Xpo1	UTSW	11	23282646	missense	probably benign
R9277:Xpo1	UTSW	11	23291550	missense	probably benign	0.17
Z1176:Xpo1	UTSW	11	23296080	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CCTCACTGAGATTGCTGGTG -3'
(R):5'- CACCATGGCTGATCTATAGTAGC -3'

Sequencing Primer
(F):5'- CTGGTGTGAGTGTAAGCCAATATGAG -3'
(R):5'- CCATGGCTGATCTATAGTAGCTATTC -3'

Posted On

2020-12-18