Mutagenetix > Incidental Mutation

Incidental Mutation 'R8509:Fancd2'

656584

Institutional Source

Beutler Lab

Gene Symbol

Fancd2

Ensembl Gene

ENSMUSG00000034023

Gene Name

Fanconi anemia, complementation group D2

Synonyms

2410150O07Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8509 (G1)

Quality Score

201.009

Status

Validated

Chromosome

Chromosomal Location

113531682-113597017 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 113572570 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 74 (T74A)

Ref Sequence

ENSEMBL: ENSMUSP00000145220 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036340] [ENSMUST00000129462] [ENSMUST00000204827]

AlphaFold

Q80V62

Predicted Effect

probably benign
Transcript: ENSMUST00000036340

SMART Domains

Protein: ENSMUSP00000045667
Gene: ENSMUSG00000034023

Domain	Start	End	E-Value	Type
Pfam:FancD2	1	1415	N/A	PFAM
low complexity region	1430	1450	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000129462
AA Change: T74A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000145220
Gene: ENSMUSG00000034023
AA Change: T74A

Domain	Start	End	E-Value	Type
Pfam:FancD2	1	80	4.9e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000204827

SMART Domains

Protein: ENSMUSP00000144928
Gene: ENSMUSG00000034023

Domain	Start	End	E-Value	Type
Pfam:FancD2	1	1402	N/A	PFAM
low complexity region	1417	1437	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

100% (44/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group D2. This protein is monoubiquinated in response to DNA damage, resulting in its localization to nuclear foci with other proteins (BRCA1 AND BRCA2) involved in homology-directed DNA repair. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutant mice exhibit defects observed in human patients with Fanconi anemia (FA) meiotic defects and germ cell loss. In addition, mutant mice display perinatal lethality, susceptiblity ot epithelial cancer, and microphthalmia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110004F10Rik	T	C	7: 116,104,434	S181P	possibly damaging	Het
4932415D10Rik	A	G	10: 82,291,116	V2020A	probably benign	Het
Angpt2	G	A	8: 18,741,119	R54*	probably null	Het
Ano3	T	C	2: 110,665,835	E858G	possibly damaging	Het
Asrgl1	T	C	19: 9,114,226	K244E	probably damaging	Het
BC048679	T	A	7: 81,495,368	T82S	probably benign	Het
Brip1	A	T	11: 86,197,948	C42*	probably null	Het
Cabcoco1	T	C	10: 68,431,289	E296G	probably damaging	Het
Ccnb1ip1	T	C	14: 50,792,257	N116S	probably benign	Het
Cep95	A	G	11: 106,805,050	E214G	probably benign	Het
Cyp11b1	A	G	15: 74,839,353	F159L	possibly damaging	Het
Dmxl2	C	A	9: 54,428,057	E660*	probably null	Het
Dnah14	C	T	1: 181,814,655	T112M		Het
Fat4	G	T	3: 38,981,903	V3235L	probably benign	Het
Gm10800	AAGAAAACTGAAAATCAT	A	2: 98,667,034		probably benign	Het
Gm40460	CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG	CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG	7: 142,240,817		probably benign	Het
Gmcl1	A	C	6: 86,722,607	I146S	probably damaging	Het
Hbb-bs	T	A	7: 103,826,712	K133*	probably null	Het
Hey1	G	C	3: 8,664,776	A207G	probably benign	Het
Hmcn1	T	A	1: 150,573,551	K5446*	probably null	Het
Hyal6	A	T	6: 24,734,606	E179D	probably damaging	Het
Inpp5b	T	A	4: 124,743,905		probably null	Het
Lrba	A	G	3: 86,348,176	K942E	probably benign	Het
Lrrcc1	A	G	3: 14,536,507	N110S	probably damaging	Het
Mcoln3	A	G	3: 146,124,892	I126V	probably benign	Het
Ncoa7	T	C	10: 30,696,052	I242V	probably benign	Het
Ndufb4	A	G	16: 37,649,144	I66T	probably benign	Het
Npffr2	T	C	5: 89,583,329	S373P	possibly damaging	Het
Olfr1165-ps	T	C	2: 88,101,522	Y155C	probably benign	Het
Pi4ka	A	T	16: 17,354,144	I579N		Het
Plscr4	C	T	9: 92,490,790	R322*	probably null	Het
Ripk2	T	C	4: 16,124,436	E424G	probably benign	Het
Rnf19b	T	A	4: 129,073,576	C304S	probably damaging	Het
Rtp1	T	C	16: 23,429,314	W46R	probably damaging	Het
Ryr2	A	G	13: 11,577,778		probably null	Het
Sbf1	A	T	15: 89,293,457	D1674E	probably damaging	Het
Sgf29	T	A	7: 126,671,662		probably benign	Het
Slc22a8	T	C	19: 8,607,975		probably null	Het
Smg6	T	C	11: 75,041,876	S998P	probably benign	Het
Srgap3	G	A	6: 112,731,336	Q801*	probably null	Het
Taf4b	A	G	18: 14,898,055	D832G	probably damaging	Het
Trim12a	T	C	7: 104,306,027	D163G	probably benign	Het
Trim46	A	G	3: 89,245,713		probably null	Het
Trpm4	A	G	7: 45,322,361	V274A	probably damaging	Het
Unc80	A	G	1: 66,641,629	D2128G	possibly damaging	Het

Other mutations in Fancd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00401:Fancd2	APN	6	113564396	critical splice donor site	probably null
IGL00475:Fancd2	APN	6	113568610	missense	probably benign	0.01
IGL01319:Fancd2	APN	6	113584899	missense	probably damaging	0.98
IGL01339:Fancd2	APN	6	113553752	missense	probably benign	0.00
IGL01373:Fancd2	APN	6	113553752	missense	probably benign	0.00
IGL01393:Fancd2	APN	6	113577360	splice site	probably benign
IGL01630:Fancd2	APN	6	113563124	missense	probably damaging	1.00
IGL01769:Fancd2	APN	6	113545111	missense	possibly damaging	0.90
IGL01882:Fancd2	APN	6	113546640	missense	probably benign	0.05
IGL02029:Fancd2	APN	6	113570975	missense	probably benign	0.44
IGL02224:Fancd2	APN	6	113568320	critical splice donor site	probably null
IGL02271:Fancd2	APN	6	113535759	splice site	probably benign
IGL02352:Fancd2	APN	6	113563112	missense	probably damaging	1.00
IGL02359:Fancd2	APN	6	113563112	missense	probably damaging	1.00
IGL02427:Fancd2	APN	6	113549352	splice site	probably null
IGL02512:Fancd2	APN	6	113570943	missense	probably damaging	1.00
IGL02530:Fancd2	APN	6	113562461	missense	probably damaging	1.00
IGL02801:Fancd2	APN	6	113593317	missense	probably benign	0.00
IGL03090:Fancd2	APN	6	113537597	splice site	probably null
IGL03247:Fancd2	APN	6	113568208	missense	probably benign	0.03
R0278:Fancd2	UTSW	6	113548448	critical splice donor site	probably null
R0401:Fancd2	UTSW	6	113548343	missense	possibly damaging	0.46
R0420:Fancd2	UTSW	6	113536979	missense	probably damaging	0.98
R0496:Fancd2	UTSW	6	113555130	splice site	probably benign
R0762:Fancd2	UTSW	6	113574658	missense	probably benign	0.20
R0827:Fancd2	UTSW	6	113586249	critical splice donor site	probably null
R1225:Fancd2	UTSW	6	113535861	missense	probably damaging	0.99
R1576:Fancd2	UTSW	6	113578405	missense	probably damaging	0.98
R2010:Fancd2	UTSW	6	113593291	missense	probably damaging	0.96
R2079:Fancd2	UTSW	6	113555187	missense	probably damaging	1.00
R2118:Fancd2	UTSW	6	113560074	splice site	probably benign
R2141:Fancd2	UTSW	6	113549321	missense	probably benign	0.00
R2168:Fancd2	UTSW	6	113591159	missense	possibly damaging	0.92
R2180:Fancd2	UTSW	6	113574637	missense	probably benign	0.33
R3016:Fancd2	UTSW	6	113536726	missense	probably benign	0.00
R3153:Fancd2	UTSW	6	113593269	missense	possibly damaging	0.55
R3154:Fancd2	UTSW	6	113593269	missense	possibly damaging	0.55
R3783:Fancd2	UTSW	6	113565204	missense	probably damaging	1.00
R3786:Fancd2	UTSW	6	113565204	missense	probably damaging	1.00
R3787:Fancd2	UTSW	6	113565204	missense	probably damaging	1.00
R4379:Fancd2	UTSW	6	113561716	missense	probably benign	0.00
R4388:Fancd2	UTSW	6	113556368	missense	probably damaging	0.99
R4544:Fancd2	UTSW	6	113572642	critical splice acceptor site	probably null
R4598:Fancd2	UTSW	6	113585477	missense	probably benign	0.06
R4832:Fancd2	UTSW	6	113553722	missense	probably benign	0.16
R4841:Fancd2	UTSW	6	113562430	missense	probably damaging	1.00
R4922:Fancd2	UTSW	6	113585473	missense	probably benign	0.03
R5375:Fancd2	UTSW	6	113568712	missense	possibly damaging	0.93
R5579:Fancd2	UTSW	6	113560051	critical splice acceptor site	probably null
R5782:Fancd2	UTSW	6	113548872	missense	probably benign	0.00
R5871:Fancd2	UTSW	6	113556282	missense	probably benign	0.30
R5901:Fancd2	UTSW	6	113549365	missense	probably damaging	1.00
R5909:Fancd2	UTSW	6	113561711	missense	probably benign
R6026:Fancd2	UTSW	6	113551770	missense	possibly damaging	0.46
R6166:Fancd2	UTSW	6	113555251	missense	possibly damaging	0.67
R6393:Fancd2	UTSW	6	113578413	missense	probably benign	0.01
R6666:Fancd2	UTSW	6	113585509	missense	probably damaging	0.96
R6669:Fancd2	UTSW	6	113593327	missense	probably benign	0.00
R6676:Fancd2	UTSW	6	113537665	nonsense	probably null
R6762:Fancd2	UTSW	6	113586016	splice site	probably null
R6911:Fancd2	UTSW	6	113548385	missense	probably damaging	0.98
R6992:Fancd2	UTSW	6	113571018	critical splice donor site	probably null
R7091:Fancd2	UTSW	6	113545101	missense	probably damaging	1.00
R7252:Fancd2	UTSW	6	113556285	missense	probably damaging	0.98
R7343:Fancd2	UTSW	6	113536939	missense	probably benign	0.01
R7344:Fancd2	UTSW	6	113568709	missense	probably benign	0.09
R7354:Fancd2	UTSW	6	113595946	missense	unknown
R7489:Fancd2	UTSW	6	113564304	missense	probably benign
R7501:Fancd2	UTSW	6	113548403	missense	possibly damaging	0.95
R7504:Fancd2	UTSW	6	113545038	missense	probably damaging	1.00
R7992:Fancd2	UTSW	6	113565204	missense	probably damaging	1.00
R8027:Fancd2	UTSW	6	113546622	missense	probably damaging	1.00
R8487:Fancd2	UTSW	6	113568226	missense	probably damaging	1.00
R8757:Fancd2	UTSW	6	113560093	missense	possibly damaging	0.91
R8960:Fancd2	UTSW	6	113563168	critical splice donor site	probably null
R8978:Fancd2	UTSW	6	113585546	splice site	probably benign
R9110:Fancd2	UTSW	6	113535801	missense	possibly damaging	0.94
R9116:Fancd2	UTSW	6	113555219	missense	probably benign	0.00
R9490:Fancd2	UTSW	6	113578455	missense	probably damaging	0.98
R9667:Fancd2	UTSW	6	113553756	nonsense	probably null
Z1088:Fancd2	UTSW	6	113581422	missense	probably benign	0.00
Z1177:Fancd2	UTSW	6	113545025	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GTGGAACGAAATATGCCCTGC -3'
(R):5'- CTTAAAGCAGCAGATTCTCTTGGC -3'

Sequencing Primer
(F):5'- TATGCCCTGCAGAAACTGG -3'
(R):5'- TTCTCTTGGCAAAAGGAGCAGTC -3'

Posted On

2021-01-13