Incidental Mutation 'R8329:Hc'
ID 656590
Institutional Source Beutler Lab
Gene Symbol Hc
Ensembl Gene ENSMUSG00000026874
Gene Name hemolytic complement
Synonyms C5, Hfib2, He, C5a
MMRRC Submission 067859-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.492) question?
Stock # R8329 (G1)
Quality Score 195.009
Status Validated
Chromosome 2
Chromosomal Location 34873343-34951450 bp(-) (GRCm39)
Type of Mutation splice site (6567 bp from exon)
DNA Base Change (assembly) G to A at 34902910 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000028233]
AlphaFold P06684
Predicted Effect probably benign
Transcript: ENSMUST00000028233
SMART Domains Protein: ENSMUSP00000028233
Gene: ENSMUSG00000026874

DomainStartEndE-ValueType
Pfam:A2M_N 125 219 1.8e-15 PFAM
A2M_N_2 465 612 9.83e-34 SMART
ANATO 702 736 4.73e-12 SMART
A2M 776 863 2.44e-29 SMART
Pfam:A2M_comp 1055 1306 2.3e-68 PFAM
A2M_recep 1423 1513 7.29e-28 SMART
C345C 1553 1665 1.51e-35 SMART
Predicted Effect probably null
Transcript: ENSMUST00000156412
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: This gene encodes a component of the complement system, a part of the innate immune system that plays an important role in inflammation, host homeostasis, and host defense against pathogens. The encoded preproprotein is proteolytically processed to generate multiple protein products, including the C5 alpha chain, C5 beta chain, C5a anaphylatoxin and C5b. The C5 protein is comprised of the alpha and beta chains, which are linked by a disulfide bridge. Cleavage of the alpha chain by a convertase enzyme results in the formation of the C5a anaphylatoxin, which possesses potent spasmogenic and chemotactic activity, and the C5b macromolecular cleavage product, a subunit of the membrane attack complex (MAC). Mice with a homozygous mutation in this gene exhibit impaired bone fracture healing and an enhanced inflammatory response in an allergic lung disease model. [provided by RefSeq, Nov 2015]
PHENOTYPE: Macrophage from mice homozygous for disruptions of this gene do not secrete complement C5.

The 2 bp deletion found in A/J and AKR/J strains is associated with susceptibility to allergen-induced bronchial hyperresponsiveness and is a candidate for QTL Abhr2.

[provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T A 4: 62,461,978 (GRCm39) probably null Het
Ackr4 A G 9: 103,976,660 (GRCm39) F96L possibly damaging Het
Aco1 T C 4: 40,186,376 (GRCm39) I596T possibly damaging Het
Aff3 G A 1: 38,244,135 (GRCm39) R879W probably benign Het
Apob A G 12: 8,061,135 (GRCm39) R3206G probably damaging Het
Atg7 T A 6: 114,663,057 (GRCm39) D224E possibly damaging Het
Capn12 T C 7: 28,582,626 (GRCm39) F167S probably damaging Het
Ccdc3 T G 2: 5,233,848 (GRCm39) V224G probably damaging Het
Ces4a G A 8: 105,874,714 (GRCm39) V452I probably damaging Het
Cherp G A 8: 73,215,852 (GRCm39) R834C Het
Clptm1l T A 13: 73,760,547 (GRCm39) I310N probably damaging Het
Cog3 A T 14: 75,978,003 (GRCm39) D230E probably damaging Het
Crb1 T A 1: 139,165,005 (GRCm39) I1101F probably damaging Het
Cts6 A T 13: 61,343,282 (GRCm39) M313K probably damaging Het
Cyp2c66 T A 19: 39,174,906 (GRCm39) C435* probably null Het
Defb13 A G 8: 22,438,562 (GRCm39) E40G probably benign Het
Dis3l T C 9: 64,219,112 (GRCm39) D606G possibly damaging Het
Dop1b T C 16: 93,568,675 (GRCm39) L1579P probably damaging Het
Foxa3 A G 7: 18,748,109 (GRCm39) V339A probably benign Het
Gcn1 G A 5: 115,747,921 (GRCm39) G1776E probably damaging Het
Gls2 A G 10: 128,037,154 (GRCm39) T232A probably benign Het
Gprc6a A T 10: 51,503,355 (GRCm39) Y169* probably null Het
Guca2b T C 4: 119,516,001 (GRCm39) S18G unknown Het
Hars2 A G 18: 36,922,288 (GRCm39) D301G possibly damaging Het
Haus5 T A 7: 30,358,984 (GRCm39) Q226L possibly damaging Het
Hivep2 T C 10: 14,004,011 (GRCm39) V203A probably damaging Het
Hoxc8 A G 15: 102,899,543 (GRCm39) Y111C probably damaging Het
Hoxd13 G T 2: 74,498,661 (GRCm39) R3L probably benign Het
Hspa8 T G 9: 40,713,897 (GRCm39) I130S probably damaging Het
Ier5l C A 2: 30,362,861 (GRCm39) C388F possibly damaging Het
Ldc1 C T 4: 130,109,156 (GRCm39) V295M possibly damaging Het
Lmx1a A G 1: 167,517,372 (GRCm39) N10S probably benign Het
Map2 T C 1: 66,454,272 (GRCm39) I1054T probably benign Het
Me1 C T 9: 86,501,790 (GRCm39) D268N probably damaging Het
Muc6 G A 7: 141,226,525 (GRCm39) P1501S unknown Het
Myo1d T C 11: 80,528,900 (GRCm39) M641V probably benign Het
Nuggc G A 14: 65,878,731 (GRCm39) R667K probably benign Het
Oprl1 T A 2: 181,360,717 (GRCm39) C231S probably damaging Het
Or11g26 T C 14: 50,753,015 (GRCm39) F118S probably damaging Het
Or13p10 A C 4: 118,523,604 (GRCm39) N297H probably damaging Het
Pard3b C A 1: 62,676,957 (GRCm39) Q1163K probably benign Het
Pik3c2a T C 7: 116,017,283 (GRCm39) Y158C probably damaging Het
Prune2 T G 19: 17,098,629 (GRCm39) S1378A probably benign Het
Ralgps2 G T 1: 156,712,110 (GRCm39) T158K probably damaging Het
Rbm42 T A 7: 30,344,582 (GRCm39) E227V unknown Het
Ripor3 T C 2: 167,825,119 (GRCm39) R797G possibly damaging Het
Ryr3 T A 2: 112,492,855 (GRCm39) H3764L possibly damaging Het
Sbno2 T C 10: 79,900,221 (GRCm39) Y541C probably damaging Het
Scn5a A G 9: 119,365,030 (GRCm39) V396A probably damaging Het
Slc36a3 A G 11: 55,039,409 (GRCm39) L73P probably damaging Het
Spag16 T C 1: 69,934,407 (GRCm39) I278T probably benign Het
Stx18 T A 5: 38,285,450 (GRCm39) L274* probably null Het
Terb1 A T 8: 105,211,003 (GRCm39) N341K probably damaging Het
Timm29 A G 9: 21,505,001 (GRCm39) Y223C probably damaging Het
Tmprss2 T A 16: 97,369,665 (GRCm39) M370L probably benign Het
Tmtc3 T A 10: 100,283,296 (GRCm39) N753I probably damaging Het
Tnpo3 A T 6: 29,558,832 (GRCm39) C699* probably null Het
Trav5d-4 G A 14: 53,239,208 (GRCm39) W13* probably null Het
Trdn A G 10: 33,320,074 (GRCm39) probably null Het
Tsg101 A T 7: 46,558,808 (GRCm39) Y68N probably damaging Het
Ttn A G 2: 76,664,062 (GRCm39) V11649A unknown Het
Wnk2 A T 13: 49,248,914 (GRCm39) V379D probably damaging Het
Xpnpep1 A G 19: 52,990,903 (GRCm39) probably null Het
Yme1l1 C T 2: 23,054,597 (GRCm39) Q139* probably null Het
Other mutations in Hc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Hc APN 2 34,881,641 (GRCm39) missense probably benign 0.00
IGL00922:Hc APN 2 34,881,680 (GRCm39) missense probably damaging 1.00
IGL01523:Hc APN 2 34,929,250 (GRCm39) missense probably benign 0.04
IGL01746:Hc APN 2 34,947,338 (GRCm39) missense probably damaging 0.98
IGL01793:Hc APN 2 34,918,202 (GRCm39) missense probably damaging 1.00
IGL01972:Hc APN 2 34,873,784 (GRCm39) missense probably damaging 1.00
IGL02037:Hc APN 2 34,903,531 (GRCm39) missense probably benign 0.16
IGL02048:Hc APN 2 34,886,039 (GRCm39) missense probably benign 0.00
IGL02227:Hc APN 2 34,899,923 (GRCm39) intron probably benign
IGL02230:Hc APN 2 34,903,682 (GRCm39) missense probably benign
IGL02254:Hc APN 2 34,874,836 (GRCm39) missense probably damaging 1.00
IGL02363:Hc APN 2 34,890,847 (GRCm39) missense probably benign
IGL02650:Hc APN 2 34,890,886 (GRCm39) missense possibly damaging 0.49
IGL03053:Hc APN 2 34,914,210 (GRCm39) missense probably benign 0.07
IGL03168:Hc APN 2 34,914,210 (GRCm39) missense probably benign 0.07
IGL03341:Hc APN 2 34,893,389 (GRCm39) missense probably damaging 0.98
PIT4142001:Hc UTSW 2 34,921,833 (GRCm39) splice site probably benign
PIT4378001:Hc UTSW 2 34,921,876 (GRCm39) missense probably benign 0.13
PIT4508001:Hc UTSW 2 34,874,816 (GRCm39) missense probably damaging 0.96
PIT4812001:Hc UTSW 2 34,919,464 (GRCm39) missense probably benign 0.16
R0025:Hc UTSW 2 34,876,304 (GRCm39) missense probably damaging 1.00
R0053:Hc UTSW 2 34,947,287 (GRCm39) missense probably benign 0.32
R0197:Hc UTSW 2 34,874,762 (GRCm39) missense probably damaging 1.00
R0218:Hc UTSW 2 34,918,086 (GRCm39) missense probably damaging 1.00
R0242:Hc UTSW 2 34,926,166 (GRCm39) splice site probably benign
R0496:Hc UTSW 2 34,903,583 (GRCm39) missense probably damaging 1.00
R1205:Hc UTSW 2 34,893,536 (GRCm39) missense possibly damaging 0.50
R1468:Hc UTSW 2 34,873,819 (GRCm39) nonsense probably null
R1468:Hc UTSW 2 34,873,819 (GRCm39) nonsense probably null
R1574:Hc UTSW 2 34,890,777 (GRCm39) intron probably benign
R1610:Hc UTSW 2 34,896,173 (GRCm39) missense probably benign 0.44
R1640:Hc UTSW 2 34,947,336 (GRCm39) nonsense probably null
R1887:Hc UTSW 2 34,924,623 (GRCm39) missense probably benign
R1920:Hc UTSW 2 34,919,407 (GRCm39) splice site probably benign
R2018:Hc UTSW 2 34,903,540 (GRCm39) missense probably damaging 1.00
R2019:Hc UTSW 2 34,903,540 (GRCm39) missense probably damaging 1.00
R2151:Hc UTSW 2 34,881,115 (GRCm39) intron probably benign
R2366:Hc UTSW 2 34,903,648 (GRCm39) missense probably benign
R4093:Hc UTSW 2 34,873,819 (GRCm39) nonsense probably null
R4288:Hc UTSW 2 34,920,414 (GRCm39) missense probably damaging 0.98
R4501:Hc UTSW 2 34,887,488 (GRCm39) splice site probably null
R4502:Hc UTSW 2 34,896,264 (GRCm39) missense probably benign 0.00
R4508:Hc UTSW 2 34,903,077 (GRCm39) missense possibly damaging 0.94
R4583:Hc UTSW 2 34,918,189 (GRCm39) missense probably benign 0.00
R4686:Hc UTSW 2 34,929,260 (GRCm39) missense possibly damaging 0.49
R4776:Hc UTSW 2 34,929,746 (GRCm39) missense probably benign 0.12
R4846:Hc UTSW 2 34,909,682 (GRCm39) missense probably benign 0.00
R5032:Hc UTSW 2 34,903,544 (GRCm39) missense probably benign 0.07
R5089:Hc UTSW 2 34,914,902 (GRCm39) missense probably benign 0.01
R5289:Hc UTSW 2 34,886,026 (GRCm39) critical splice donor site probably null
R5347:Hc UTSW 2 34,927,636 (GRCm39) missense probably benign 0.04
R5356:Hc UTSW 2 34,885,007 (GRCm39) missense probably benign 0.00
R5379:Hc UTSW 2 34,881,077 (GRCm39) missense probably damaging 1.00
R5403:Hc UTSW 2 34,947,446 (GRCm39) missense probably damaging 1.00
R5418:Hc UTSW 2 34,898,195 (GRCm39) critical splice donor site probably null
R5450:Hc UTSW 2 34,903,050 (GRCm39) missense possibly damaging 0.67
R5494:Hc UTSW 2 34,893,551 (GRCm39) splice site probably null
R5713:Hc UTSW 2 34,903,543 (GRCm39) missense probably damaging 0.99
R5898:Hc UTSW 2 34,887,449 (GRCm39) missense probably benign 0.06
R5925:Hc UTSW 2 34,920,462 (GRCm39) missense possibly damaging 0.92
R5942:Hc UTSW 2 34,918,137 (GRCm39) nonsense probably null
R5991:Hc UTSW 2 34,896,117 (GRCm39) missense possibly damaging 0.91
R6036:Hc UTSW 2 34,929,696 (GRCm39) missense probably benign 0.00
R6036:Hc UTSW 2 34,929,696 (GRCm39) missense probably benign 0.00
R6115:Hc UTSW 2 34,903,050 (GRCm39) missense probably damaging 1.00
R6234:Hc UTSW 2 34,918,058 (GRCm39) missense probably benign
R6264:Hc UTSW 2 34,896,285 (GRCm39) critical splice acceptor site probably null
R6313:Hc UTSW 2 34,879,851 (GRCm39) splice site probably null
R6525:Hc UTSW 2 34,881,236 (GRCm39) missense probably benign 0.06
R6577:Hc UTSW 2 34,922,138 (GRCm39) missense probably benign 0.00
R6601:Hc UTSW 2 34,935,906 (GRCm39) missense probably benign 0.03
R6916:Hc UTSW 2 34,900,044 (GRCm39) nonsense probably null
R7108:Hc UTSW 2 34,929,706 (GRCm39) missense probably benign 0.03
R7143:Hc UTSW 2 34,940,450 (GRCm39) missense probably benign 0.00
R7388:Hc UTSW 2 34,874,859 (GRCm39) splice site probably null
R7468:Hc UTSW 2 34,918,063 (GRCm39) missense probably benign 0.00
R7504:Hc UTSW 2 34,951,331 (GRCm39) missense not run
R7521:Hc UTSW 2 34,935,344 (GRCm39) missense possibly damaging 0.80
R7582:Hc UTSW 2 34,881,278 (GRCm39) missense possibly damaging 0.70
R7596:Hc UTSW 2 34,890,859 (GRCm39) missense probably damaging 0.96
R7599:Hc UTSW 2 34,940,431 (GRCm39) missense probably damaging 1.00
R7692:Hc UTSW 2 34,914,161 (GRCm39) missense probably damaging 1.00
R7853:Hc UTSW 2 34,900,045 (GRCm39) missense probably damaging 1.00
R7877:Hc UTSW 2 34,887,411 (GRCm39) nonsense probably null
R8375:Hc UTSW 2 34,873,731 (GRCm39) missense probably benign 0.32
R8477:Hc UTSW 2 34,879,182 (GRCm39) missense probably damaging 1.00
R8810:Hc UTSW 2 34,909,535 (GRCm39) missense probably benign 0.06
R8888:Hc UTSW 2 34,890,861 (GRCm39) missense probably benign 0.00
R8895:Hc UTSW 2 34,890,861 (GRCm39) missense probably benign 0.00
R8968:Hc UTSW 2 34,922,317 (GRCm39) missense possibly damaging 0.91
R8969:Hc UTSW 2 34,909,475 (GRCm39) critical splice donor site probably null
R9146:Hc UTSW 2 34,924,571 (GRCm39) missense probably damaging 1.00
R9218:Hc UTSW 2 34,922,203 (GRCm39) missense probably damaging 1.00
R9340:Hc UTSW 2 34,876,294 (GRCm39) missense probably damaging 0.99
R9396:Hc UTSW 2 34,927,615 (GRCm39) nonsense probably null
R9569:Hc UTSW 2 34,926,359 (GRCm39) missense probably benign 0.00
R9576:Hc UTSW 2 34,873,767 (GRCm39) missense probably benign 0.01
R9706:Hc UTSW 2 34,914,196 (GRCm39) missense probably damaging 1.00
X0066:Hc UTSW 2 34,873,723 (GRCm39) missense probably damaging 1.00
Z1088:Hc UTSW 2 34,919,482 (GRCm39) missense probably benign 0.02
Z1088:Hc UTSW 2 34,898,261 (GRCm39) missense possibly damaging 0.94
Z1176:Hc UTSW 2 34,896,285 (GRCm39) critical splice acceptor site probably null
Z1177:Hc UTSW 2 34,903,622 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTGTCTGAAGTTAGAAGAACGAG -3'
(R):5'- TGGTGAGCGTCATGTCCTAC -3'

Sequencing Primer
(F):5'- CCACACCTAGATCAGATGTAGTTG -3'
(R):5'- GTGAGCGTCATGTCCTACAGAAAC -3'
Posted On 2021-01-13