Incidental Mutation 'R8329:Hc'
ID 656590
Institutional Source Beutler Lab
Gene Symbol Hc
Ensembl Gene ENSMUSG00000026874
Gene Name hemolytic complement
Synonyms He, C5, C5a
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.487) question?
Stock # R8329 (G1)
Quality Score 195.009
Status Validated
Chromosome 2
Chromosomal Location 34983331-35061438 bp(-) (GRCm38)
Type of Mutation splice site (6567 bp from exon)
DNA Base Change (assembly) G to A at 35012898 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000028233]
AlphaFold P06684
Predicted Effect probably benign
Transcript: ENSMUST00000028233
SMART Domains Protein: ENSMUSP00000028233
Gene: ENSMUSG00000026874

DomainStartEndE-ValueType
Pfam:A2M_N 125 219 1.8e-15 PFAM
A2M_N_2 465 612 9.83e-34 SMART
ANATO 702 736 4.73e-12 SMART
A2M 776 863 2.44e-29 SMART
Pfam:A2M_comp 1055 1306 2.3e-68 PFAM
A2M_recep 1423 1513 7.29e-28 SMART
C345C 1553 1665 1.51e-35 SMART
Predicted Effect probably null
Transcript: ENSMUST00000156412
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: This gene encodes a component of the complement system, a part of the innate immune system that plays an important role in inflammation, host homeostasis, and host defense against pathogens. The encoded preproprotein is proteolytically processed to generate multiple protein products, including the C5 alpha chain, C5 beta chain, C5a anaphylatoxin and C5b. The C5 protein is comprised of the alpha and beta chains, which are linked by a disulfide bridge. Cleavage of the alpha chain by a convertase enzyme results in the formation of the C5a anaphylatoxin, which possesses potent spasmogenic and chemotactic activity, and the C5b macromolecular cleavage product, a subunit of the membrane attack complex (MAC). Mice with a homozygous mutation in this gene exhibit impaired bone fracture healing and an enhanced inflammatory response in an allergic lung disease model. [provided by RefSeq, Nov 2015]
PHENOTYPE: Macrophage from mice homozygous for disruptions of this gene do not secrete complement C5.

The 2 bp deletion found in A/J and AKR/J strains is associated with susceptibility to allergen-induced bronchial hyperresponsiveness and is a candidate for QTL Abhr2.

[provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T A 4: 62,543,741 probably null Het
Ackr4 A G 9: 104,099,461 F96L possibly damaging Het
Aco1 T C 4: 40,186,376 I596T possibly damaging Het
Aff3 G A 1: 38,205,054 R879W probably benign Het
Apob A G 12: 8,011,135 R3206G probably damaging Het
Atg7 T A 6: 114,686,096 D224E possibly damaging Het
Capn12 T C 7: 28,883,201 F167S probably damaging Het
Ccdc3 T G 2: 5,229,037 V224G probably damaging Het
Ces4a G A 8: 105,148,082 V452I probably damaging Het
Cherp G A 8: 72,462,008 R834C Het
Clptm1l T A 13: 73,612,428 I310N probably damaging Het
Cog3 A T 14: 75,740,563 D230E probably damaging Het
Crb1 T A 1: 139,237,267 I1101F probably damaging Het
Cts6 A T 13: 61,195,468 M313K probably damaging Het
Cyp2c66 T A 19: 39,186,462 C435* probably null Het
Defb13 A G 8: 21,948,546 E40G probably benign Het
Dis3l T C 9: 64,311,830 D606G possibly damaging Het
Dopey2 T C 16: 93,771,787 L1579P probably damaging Het
Foxa3 A G 7: 19,014,184 V339A probably benign Het
Gcn1l1 G A 5: 115,609,862 G1776E probably damaging Het
Gls2 A G 10: 128,201,285 T232A probably benign Het
Gm853 C T 4: 130,215,363 V295M possibly damaging Het
Gprc6a A T 10: 51,627,259 Y169* probably null Het
Guca2b T C 4: 119,658,804 S18G unknown Het
Hars2 A G 18: 36,789,235 D301G possibly damaging Het
Haus5 T A 7: 30,659,559 Q226L possibly damaging Het
Hivep2 T C 10: 14,128,267 V203A probably damaging Het
Hoxc8 A G 15: 102,991,111 Y111C probably damaging Het
Hoxd13 G T 2: 74,668,317 R3L probably benign Het
Hspa8 T G 9: 40,802,601 I130S probably damaging Het
Ier5l C A 2: 30,472,849 C388F possibly damaging Het
Lmx1a A G 1: 167,689,803 N10S probably benign Het
Map2 T C 1: 66,415,113 I1054T probably benign Het
Me1 C T 9: 86,619,737 D268N probably damaging Het
Muc6 G A 7: 141,640,258 P1501S unknown Het
Myo1d T C 11: 80,638,074 M641V probably benign Het
Nuggc G A 14: 65,641,282 R667K probably benign Het
Olfr62 A C 4: 118,666,407 N297H probably damaging Het
Olfr742 T C 14: 50,515,558 F118S probably damaging Het
Oprl1 T A 2: 181,718,924 C231S probably damaging Het
Pard3b C A 1: 62,637,798 Q1163K probably benign Het
Pik3c2a T C 7: 116,418,048 Y158C probably damaging Het
Prune2 T G 19: 17,121,265 S1378A probably benign Het
Ralgps2 G T 1: 156,884,540 T158K probably damaging Het
Rbm42 T A 7: 30,645,157 E227V unknown Het
Ripor3 T C 2: 167,983,199 R797G possibly damaging Het
Ryr3 T A 2: 112,662,510 H3764L possibly damaging Het
Sbno2 T C 10: 80,064,387 Y541C probably damaging Het
Scn5a A G 9: 119,535,964 V396A probably damaging Het
Slc36a3 A G 11: 55,148,583 L73P probably damaging Het
Spag16 T C 1: 69,895,248 I278T probably benign Het
Stx18 T A 5: 38,128,106 L274* probably null Het
Terb1 A T 8: 104,484,371 N341K probably damaging Het
Timm29 A G 9: 21,593,705 Y223C probably damaging Het
Tmprss2 T A 16: 97,568,465 M370L probably benign Het
Tmtc3 T A 10: 100,447,434 N753I probably damaging Het
Tnpo3 A T 6: 29,558,833 C699* probably null Het
Trav5d-4 G A 14: 53,001,751 W13* probably null Het
Trdn A G 10: 33,444,078 probably null Het
Tsg101 A T 7: 46,909,060 Y68N probably damaging Het
Ttn A G 2: 76,833,718 V11649A unknown Het
Wnk2 A T 13: 49,095,438 V379D probably damaging Het
Xpnpep1 A G 19: 53,002,472 probably null Het
Yme1l1 C T 2: 23,164,585 Q139* probably null Het
Other mutations in Hc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Hc APN 2 34991629 missense probably benign 0.00
IGL00922:Hc APN 2 34991668 missense probably damaging 1.00
IGL01523:Hc APN 2 35039238 missense probably benign 0.04
IGL01746:Hc APN 2 35057326 missense probably damaging 0.98
IGL01793:Hc APN 2 35028190 missense probably damaging 1.00
IGL01972:Hc APN 2 34983772 missense probably damaging 1.00
IGL02037:Hc APN 2 35013519 missense probably benign 0.16
IGL02048:Hc APN 2 34996027 missense probably benign 0.00
IGL02227:Hc APN 2 35009911 intron probably benign
IGL02230:Hc APN 2 35013670 missense probably benign
IGL02254:Hc APN 2 34984824 missense probably damaging 1.00
IGL02363:Hc APN 2 35000835 missense probably benign
IGL02650:Hc APN 2 35000874 missense possibly damaging 0.49
IGL03053:Hc APN 2 35024198 missense probably benign 0.07
IGL03168:Hc APN 2 35024198 missense probably benign 0.07
IGL03341:Hc APN 2 35003377 missense probably damaging 0.98
PIT4142001:Hc UTSW 2 35031821 splice site probably benign
PIT4378001:Hc UTSW 2 35031864 missense probably benign 0.13
PIT4508001:Hc UTSW 2 34984804 missense probably damaging 0.96
PIT4812001:Hc UTSW 2 35029452 missense probably benign 0.16
R0025:Hc UTSW 2 34986292 missense probably damaging 1.00
R0053:Hc UTSW 2 35057275 missense probably benign 0.32
R0197:Hc UTSW 2 34984750 missense probably damaging 1.00
R0218:Hc UTSW 2 35028074 missense probably damaging 1.00
R0242:Hc UTSW 2 35036154 splice site probably benign
R0496:Hc UTSW 2 35013571 missense probably damaging 1.00
R1205:Hc UTSW 2 35003524 missense possibly damaging 0.50
R1468:Hc UTSW 2 34983807 nonsense probably null
R1468:Hc UTSW 2 34983807 nonsense probably null
R1574:Hc UTSW 2 35000765 intron probably benign
R1610:Hc UTSW 2 35006161 missense probably benign 0.44
R1640:Hc UTSW 2 35057324 nonsense probably null
R1887:Hc UTSW 2 35034611 missense probably benign
R1920:Hc UTSW 2 35029395 splice site probably benign
R2018:Hc UTSW 2 35013528 missense probably damaging 1.00
R2019:Hc UTSW 2 35013528 missense probably damaging 1.00
R2151:Hc UTSW 2 34991103 intron probably benign
R2366:Hc UTSW 2 35013636 missense probably benign
R4093:Hc UTSW 2 34983807 nonsense probably null
R4288:Hc UTSW 2 35030402 missense probably damaging 0.98
R4501:Hc UTSW 2 34997476 splice site probably null
R4502:Hc UTSW 2 35006252 missense probably benign 0.00
R4508:Hc UTSW 2 35013065 missense possibly damaging 0.94
R4583:Hc UTSW 2 35028177 missense probably benign 0.00
R4686:Hc UTSW 2 35039248 missense possibly damaging 0.49
R4776:Hc UTSW 2 35039734 missense probably benign 0.12
R4846:Hc UTSW 2 35019670 missense probably benign 0.00
R5032:Hc UTSW 2 35013532 missense probably benign 0.07
R5089:Hc UTSW 2 35024890 missense probably benign 0.01
R5289:Hc UTSW 2 34996014 critical splice donor site probably null
R5347:Hc UTSW 2 35037624 missense probably benign 0.04
R5356:Hc UTSW 2 34994995 missense probably benign 0.00
R5379:Hc UTSW 2 34991065 missense probably damaging 1.00
R5403:Hc UTSW 2 35057434 missense probably damaging 1.00
R5418:Hc UTSW 2 35008183 critical splice donor site probably null
R5450:Hc UTSW 2 35013038 missense possibly damaging 0.67
R5494:Hc UTSW 2 35003539 splice site probably null
R5713:Hc UTSW 2 35013531 missense probably damaging 0.99
R5898:Hc UTSW 2 34997437 missense probably benign 0.06
R5925:Hc UTSW 2 35030450 missense possibly damaging 0.92
R5942:Hc UTSW 2 35028125 nonsense probably null
R5991:Hc UTSW 2 35006105 missense possibly damaging 0.91
R6036:Hc UTSW 2 35039684 missense probably benign 0.00
R6036:Hc UTSW 2 35039684 missense probably benign 0.00
R6115:Hc UTSW 2 35013038 missense probably damaging 1.00
R6234:Hc UTSW 2 35028046 missense probably benign
R6264:Hc UTSW 2 35006273 critical splice acceptor site probably null
R6313:Hc UTSW 2 34989839 splice site probably null
R6525:Hc UTSW 2 34991224 missense probably benign 0.06
R6577:Hc UTSW 2 35032126 missense probably benign 0.00
R6601:Hc UTSW 2 35045894 missense probably benign 0.03
R6916:Hc UTSW 2 35010032 nonsense probably null
R7108:Hc UTSW 2 35039694 missense probably benign 0.03
R7143:Hc UTSW 2 35050438 missense probably benign 0.00
R7388:Hc UTSW 2 34984847 splice site probably null
R7468:Hc UTSW 2 35028051 missense probably benign 0.00
R7504:Hc UTSW 2 35061319 missense not run
R7521:Hc UTSW 2 35045332 missense possibly damaging 0.80
R7582:Hc UTSW 2 34991266 missense possibly damaging 0.70
R7596:Hc UTSW 2 35000847 missense probably damaging 0.96
R7599:Hc UTSW 2 35050419 missense probably damaging 1.00
R7692:Hc UTSW 2 35024149 missense probably damaging 1.00
R7853:Hc UTSW 2 35010033 missense probably damaging 1.00
R7877:Hc UTSW 2 34997399 nonsense probably null
R8375:Hc UTSW 2 34983719 missense probably benign 0.32
R8477:Hc UTSW 2 34989170 missense probably damaging 1.00
R8810:Hc UTSW 2 35019523 missense probably benign 0.06
R8888:Hc UTSW 2 35000849 missense probably benign 0.00
R8895:Hc UTSW 2 35000849 missense probably benign 0.00
R8968:Hc UTSW 2 35032305 missense possibly damaging 0.91
R8969:Hc UTSW 2 35019463 critical splice donor site probably null
R9146:Hc UTSW 2 35034559 missense probably damaging 1.00
R9218:Hc UTSW 2 35032191 missense probably damaging 1.00
R9340:Hc UTSW 2 34986282 missense probably damaging 0.99
R9396:Hc UTSW 2 35037603 nonsense probably null
R9569:Hc UTSW 2 35036347 missense probably benign 0.00
R9576:Hc UTSW 2 34983755 missense probably benign 0.01
R9706:Hc UTSW 2 35024184 missense probably damaging 1.00
X0066:Hc UTSW 2 34983711 missense probably damaging 1.00
Z1088:Hc UTSW 2 35008249 missense possibly damaging 0.94
Z1088:Hc UTSW 2 35029470 missense probably benign 0.02
Z1176:Hc UTSW 2 35006273 critical splice acceptor site probably null
Z1177:Hc UTSW 2 35013610 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTGTCTGAAGTTAGAAGAACGAG -3'
(R):5'- TGGTGAGCGTCATGTCCTAC -3'

Sequencing Primer
(F):5'- CCACACCTAGATCAGATGTAGTTG -3'
(R):5'- GTGAGCGTCATGTCCTACAGAAAC -3'
Posted On 2021-01-13