Mutagenetix > Incidental Mutation

Incidental Mutation 'R8329:Trdn'

656591

Institutional Source

Beutler Lab

Gene Symbol

Trdn

Ensembl Gene

ENSMUSG00000019787

Gene Name

triadin

Synonyms

triadin-2, triadin 2, triadin 1, triadin 3, EG432451, 2310045H21Rik, triadin-1, triadin-3

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.066) question?

Stock #

R8329 (G1)

Quality Score

130.008

Status

Not validated

Chromosome

Chromosomal Location

33080554-33476709 bp(+) (GRCm38)

Type of Mutation

splice site (4 bp from exon)

DNA Base Change (assembly)

A to G at 33444078 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000093436 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095762]

AlphaFold

E9Q9K5

Predicted Effect

probably null
Transcript: ENSMUST00000095762

SMART Domains

Protein: ENSMUSP00000093436
Gene: ENSMUSG00000019787

Domain	Start	End	E-Value	Type
SCOP:d1lnqa2	49	116	1e-4	SMART
low complexity region	147	158	N/A	INTRINSIC
low complexity region	166	182	N/A	INTRINSIC
low complexity region	198	223	N/A	INTRINSIC
low complexity region	229	250	N/A	INTRINSIC
coiled coil region	306	333	N/A	INTRINSIC
low complexity region	342	352	N/A	INTRINSIC
low complexity region	380	396	N/A	INTRINSIC
coiled coil region	417	437	N/A	INTRINSIC
low complexity region	448	484	N/A	INTRINSIC
low complexity region	539	551	N/A	INTRINSIC
low complexity region	559	572	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein that contains a single transmembrane domain. As similar protein in rabbits plays a role in skeletal muscle excitation-contraction coupling as part of the calcium release complex in association with the ryanodine receptor. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and single nucleotide polymorphisms in this gene may be markers for IgA nephritis. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit a loss of transverse orientation of triads within skeletal muscle cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933430I17Rik	T	A	4: 62,543,741		probably null	Het
Ackr4	A	G	9: 104,099,461	F96L	possibly damaging	Het
Aco1	T	C	4: 40,186,376	I596T	possibly damaging	Het
Aff3	G	A	1: 38,205,054	R879W	probably benign	Het
Apob	A	G	12: 8,011,135	R3206G	probably damaging	Het
Atg7	T	A	6: 114,686,096	D224E	possibly damaging	Het
Capn12	T	C	7: 28,883,201	F167S	probably damaging	Het
Ccdc3	T	G	2: 5,229,037	V224G	probably damaging	Het
Ces4a	G	A	8: 105,148,082	V452I	probably damaging	Het
Cherp	G	A	8: 72,462,008	R834C		Het
Clptm1l	T	A	13: 73,612,428	I310N	probably damaging	Het
Cog3	A	T	14: 75,740,563	D230E	probably damaging	Het
Crb1	T	A	1: 139,237,267	I1101F	probably damaging	Het
Cts6	A	T	13: 61,195,468	M313K	probably damaging	Het
Cyp2c66	T	A	19: 39,186,462	C435*	probably null	Het
Defb13	A	G	8: 21,948,546	E40G	probably benign	Het
Dis3l	T	C	9: 64,311,830	D606G	possibly damaging	Het
Dopey2	T	C	16: 93,771,787	L1579P	probably damaging	Het
Foxa3	A	G	7: 19,014,184	V339A	probably benign	Het
Gcn1l1	G	A	5: 115,609,862	G1776E	probably damaging	Het
Gls2	A	G	10: 128,201,285	T232A	probably benign	Het
Gm853	C	T	4: 130,215,363	V295M	possibly damaging	Het
Gprc6a	A	T	10: 51,627,259	Y169*	probably null	Het
Guca2b	T	C	4: 119,658,804	S18G	unknown	Het
Hars2	A	G	18: 36,789,235	D301G	possibly damaging	Het
Haus5	T	A	7: 30,659,559	Q226L	possibly damaging	Het
Hc	G	A	2: 35,012,898		probably null	Het
Hivep2	T	C	10: 14,128,267	V203A	probably damaging	Het
Hoxc8	A	G	15: 102,991,111	Y111C	probably damaging	Het
Hoxd13	G	T	2: 74,668,317	R3L	probably benign	Het
Hspa8	T	G	9: 40,802,601	I130S	probably damaging	Het
Ier5l	C	A	2: 30,472,849	C388F	possibly damaging	Het
Lmx1a	A	G	1: 167,689,803	N10S	probably benign	Het
Map2	T	C	1: 66,415,113	I1054T	probably benign	Het
Me1	C	T	9: 86,619,737	D268N	probably damaging	Het
Muc6	G	A	7: 141,640,258	P1501S	unknown	Het
Myo1d	T	C	11: 80,638,074	M641V	probably benign	Het
Nuggc	G	A	14: 65,641,282	R667K	probably benign	Het
Olfr62	A	C	4: 118,666,407	N297H	probably damaging	Het
Olfr742	T	C	14: 50,515,558	F118S	probably damaging	Het
Oprl1	T	A	2: 181,718,924	C231S	probably damaging	Het
Pard3b	C	A	1: 62,637,798	Q1163K	probably benign	Het
Pik3c2a	T	C	7: 116,418,048	Y158C	probably damaging	Het
Prune2	T	G	19: 17,121,265	S1378A	probably benign	Het
Ralgps2	G	T	1: 156,884,540	T158K	probably damaging	Het
Rbm42	T	A	7: 30,645,157	E227V	unknown	Het
Ripor3	T	C	2: 167,983,199	R797G	possibly damaging	Het
Ryr3	T	A	2: 112,662,510	H3764L	possibly damaging	Het
Sbno2	T	C	10: 80,064,387	Y541C	probably damaging	Het
Scn5a	A	G	9: 119,535,964	V396A	probably damaging	Het
Slc36a3	A	G	11: 55,148,583	L73P	probably damaging	Het
Spag16	T	C	1: 69,895,248	I278T	probably benign	Het
Stx18	T	A	5: 38,128,106	L274*	probably null	Het
Terb1	A	T	8: 104,484,371	N341K	probably damaging	Het
Timm29	A	G	9: 21,593,705	Y223C	probably damaging	Het
Tmprss2	T	A	16: 97,568,465	M370L	probably benign	Het
Tmtc3	T	A	10: 100,447,434	N753I	probably damaging	Het
Tnpo3	A	T	6: 29,558,833	C699*	probably null	Het
Trav5d-4	G	A	14: 53,001,751	W13*	probably null	Het
Tsg101	A	T	7: 46,909,060	Y68N	probably damaging	Het
Ttn	A	G	2: 76,833,718	V11649A	unknown	Het
Wnk2	A	T	13: 49,095,438	V379D	probably damaging	Het
Xpnpep1	A	G	19: 53,002,472		probably null	Het
Yme1l1	C	T	2: 23,164,585	Q139*	probably null	Het

Other mutations in Trdn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00839:Trdn	APN	10	33471606	critical splice donor site	probably null
IGL01310:Trdn	APN	10	33305098	splice site	probably benign
IGL01313:Trdn	APN	10	33200220	missense	probably damaging	1.00
IGL02177:Trdn	APN	10	33139173	missense	probably damaging	1.00
IGL02631:Trdn	APN	10	33363976	critical splice acceptor site	probably null
IGL02732:Trdn	APN	10	33468199	splice site	probably null
IGL03131:Trdn	APN	10	33398414	nonsense	probably null
Button	UTSW	10	33474453	missense	probably damaging	0.97
R0463:Trdn	UTSW	10	33466421	critical splice acceptor site	probably null
R0610:Trdn	UTSW	10	33474453	missense	probably damaging	0.97
R0786:Trdn	UTSW	10	33305081	missense	probably benign	0.22
R0827:Trdn	UTSW	10	33399158	splice site	probably benign
R1511:Trdn	UTSW	10	33466452	missense	probably benign	0.18
R1623:Trdn	UTSW	10	33258102	missense	possibly damaging	0.82
R1760:Trdn	UTSW	10	33233887	missense	possibly damaging	0.92
R1766:Trdn	UTSW	10	33364008	missense	probably damaging	1.00
R1884:Trdn	UTSW	10	33257095	missense	probably benign	0.38
R2297:Trdn	UTSW	10	33335012	missense	probably damaging	1.00
R2396:Trdn	UTSW	10	33195982	missense	probably damaging	1.00
R3436:Trdn	UTSW	10	33468195	critical splice donor site	probably null
R3686:Trdn	UTSW	10	33468189	missense	probably benign	0.20
R3696:Trdn	UTSW	10	33305032	splice site	probably null
R3701:Trdn	UTSW	10	33334984	missense	probably damaging	0.99
R3712:Trdn	UTSW	10	33157166	missense	probably benign	0.03
R4062:Trdn	UTSW	10	33257087	missense	probably benign	0.05
R4249:Trdn	UTSW	10	33450998	missense	probably benign	0.09
R4289:Trdn	UTSW	10	33464582	missense	probably benign	0.00
R4646:Trdn	UTSW	10	33195981	nonsense	probably null
R4647:Trdn	UTSW	10	33195981	nonsense	probably null
R4648:Trdn	UTSW	10	33195981	nonsense	probably null
R4766:Trdn	UTSW	10	33474506	missense	probably benign	0.04
R4776:Trdn	UTSW	10	33399082	splice site	probably null
R4880:Trdn	UTSW	10	33471579	missense	probably benign	0.26
R4898:Trdn	UTSW	10	33474417	missense	probably damaging	0.96
R5017:Trdn	UTSW	10	33468159	missense	probably benign	0.05
R5300:Trdn	UTSW	10	33195982	missense	probably damaging	1.00
R5320:Trdn	UTSW	10	33333251	critical splice donor site	probably null
R6089:Trdn	UTSW	10	33464575	missense	probably benign	0.01
R6216:Trdn	UTSW	10	33305069	missense	probably damaging	1.00
R6431:Trdn	UTSW	10	33139114	missense	probably damaging	1.00
R6475:Trdn	UTSW	10	33464555	splice site	probably null
R6501:Trdn	UTSW	10	33466454	missense	probably benign	0.02
R6662:Trdn	UTSW	10	33474487	missense	probably damaging	0.98
R6709:Trdn	UTSW	10	33464591	missense	probably benign	0.00
R6783:Trdn	UTSW	10	33438815	missense	probably damaging	0.96
R6906:Trdn	UTSW	10	33233948	missense	probably benign
R6916:Trdn	UTSW	10	33157018	missense	probably damaging	1.00
R7291:Trdn	UTSW	10	33437736	missense	probably null	0.83
R7499:Trdn	UTSW	10	33196101	missense	probably benign
R7601:Trdn	UTSW	10	33196156	missense	probably benign	0.00
R7743:Trdn	UTSW	10	33257062	nonsense	probably null
R8114:Trdn	UTSW	10	33083628	start gained	probably benign
R8220:Trdn	UTSW	10	33450985	missense	possibly damaging	0.57
R8228:Trdn	UTSW	10	33157018	missense	probably damaging	1.00
R8918:Trdn	UTSW	10	33139121	missense	probably benign	0.33
R9304:Trdn	UTSW	10	33305091	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GGATTCCCAGAAAGAACAATGACTG -3'
(R):5'- AGTATCCCATGTCAATCAAAGTCTG -3'

Sequencing Primer
(F):5'- ACCAAGTTCTATATCTGTTCTATGGG -3'
(R):5'- ACCTAGGAATGTGTGAATGGTG -3'

Posted On

2021-01-13