Incidental Mutation 'R8462:Stim1'
ID 656606
Institutional Source Beutler Lab
Gene Symbol Stim1
Ensembl Gene ENSMUSG00000030987
Gene Name stromal interaction molecule 1
Synonyms SIM
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8462 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 102267806-102437319 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 102427117 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 425 (E425G)
Ref Sequence ENSEMBL: ENSMUSP00000147410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033289] [ENSMUST00000209255] [ENSMUST00000211457]
AlphaFold P70302
Predicted Effect probably damaging
Transcript: ENSMUST00000033289
AA Change: E425G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000033289
Gene: ENSMUSG00000030987
AA Change: E425G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 32 47 N/A INTRINSIC
SAM 129 200 5.51e-6 SMART
SCOP:d1eq1a_ 229 334 1e-2 SMART
PDB:4O9B|D 237 340 3e-59 PDB
Pfam:SOAR 341 441 1.4e-46 PFAM
low complexity region 485 499 N/A INTRINSIC
low complexity region 601 631 N/A INTRINSIC
low complexity region 672 685 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000209255
AA Change: E425G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000211457
AA Change: E425G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type 1 transmembrane protein that mediates Ca2+ influx after depletion of intracellular Ca2+ stores by gating of store-operated Ca2+ influx channels (SOCs). It is one of several genes located in the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocrotical carcinoma, and lung, ovarian, and breast cancer. This gene may play a role in malignancies and disease that involve this region, as well as early hematopoiesis, by mediating attachment to stromal cells. Mutations in this gene are associated with fatal classic Kaposi sarcoma, immunodeficiency due to defects in store-operated calcium entry (SOCE) in fibroblasts, ectodermal dysplasia and tubular aggregate myopathy. This gene is oriented in a head-to-tail configuration with the ribonucleotide reductase 1 gene (RRM1), with the 3' end of this gene situated 1.6 kb from the 5' end of the RRM1 gene. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit perinatal and postnatal lethality, with all mice dying by 2 weeks of age, and severe growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544G11Rik T C 6: 65,953,090 V103A possibly damaging Het
Abcb11 T C 2: 69,274,155 N729S probably benign Het
Ap2a2 T A 7: 141,630,481 N883K probably damaging Het
Atr T C 9: 95,867,526 I464T probably benign Het
Atrn T A 2: 130,935,584 H184Q probably damaging Het
Bmp5 A G 9: 75,839,592 D244G probably benign Het
Celsr2 C A 3: 108,412,851 E882* probably null Het
Cfap58 T A 19: 47,983,650 V673E possibly damaging Het
Chl1 A G 6: 103,729,169 N1155S probably benign Het
Colgalt2 C A 1: 152,503,072 H416Q probably damaging Het
Dab1 C T 4: 104,704,207 L230F probably benign Het
Dixdc1 G T 9: 50,710,779 S84* probably null Het
Dnah8 A G 17: 30,656,629 D475G probably damaging Het
Egr2 T A 10: 67,538,343 N54K probably null Het
Grm3 T C 5: 9,512,365 D495G probably benign Het
Kif1b G A 4: 149,182,340 T1629I probably benign Het
Klf2 A T 8: 72,319,529 N59I probably benign Het
Krt86 T C 15: 101,479,403 V436A probably benign Het
Lrrk2 T C 15: 91,731,477 V838A probably benign Het
Ltbp1 T C 17: 75,313,074 S786P probably damaging Het
Matk C G 10: 81,262,025 R315G probably damaging Het
Meikin T C 11: 54,399,840 V249A probably benign Het
Mrnip A G 11: 50,199,827 R273G probably benign Het
Naf1 GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC 8: 66,860,548 probably benign Het
Nsd1 T A 13: 55,298,376 probably null Het
Pitpnm1 A T 19: 4,105,135 H321L probably benign Het
Plekhm2 T C 4: 141,639,819 Y170C probably damaging Het
Ralgapa1 T C 12: 55,676,518 D2197G possibly damaging Het
Rmdn2 C T 17: 79,670,624 T338M probably damaging Het
Rps10 A G 17: 27,634,234 S54P probably damaging Het
S100a11 T C 3: 93,526,115 S89P probably benign Het
Sh3yl1 T C 12: 30,942,073 Y176H probably damaging Het
Sppl2c G T 11: 104,186,706 A111S possibly damaging Het
Stab2 T C 10: 86,967,734 E317G possibly damaging Het
Stxbp1 C T 2: 32,817,281 probably null Het
Traf6 G A 2: 101,697,456 R517Q probably damaging Het
Ttn A G 2: 76,974,043 V295A probably damaging Het
Vps45 A T 3: 96,033,779 D383E possibly damaging Het
Zfp984 A G 4: 147,755,339 C352R probably damaging Het
Other mutations in Stim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Stim1 APN 7 102426747 missense probably damaging 1.00
IGL01390:Stim1 APN 7 102427162 missense possibly damaging 0.73
IGL01602:Stim1 APN 7 102386115 missense possibly damaging 0.86
IGL01605:Stim1 APN 7 102386115 missense possibly damaging 0.86
IGL01697:Stim1 APN 7 102425969 splice site probably benign
IGL01826:Stim1 APN 7 102427075 splice site probably benign
IGL01908:Stim1 APN 7 102435650 missense probably benign
IGL02869:Stim1 APN 7 102268551 missense unknown
IGL03146:Stim1 APN 7 102421355 missense probably damaging 1.00
R0217:Stim1 UTSW 7 102435800 missense probably benign 0.00
R1320:Stim1 UTSW 7 102408406 missense possibly damaging 0.79
R1639:Stim1 UTSW 7 102354541 missense probably benign 0.31
R1643:Stim1 UTSW 7 102386100 missense possibly damaging 0.92
R1697:Stim1 UTSW 7 102354506 missense probably damaging 1.00
R2424:Stim1 UTSW 7 102408405 missense probably benign 0.03
R3838:Stim1 UTSW 7 102411296 missense possibly damaging 0.71
R3940:Stim1 UTSW 7 102435641 missense probably benign 0.00
R4820:Stim1 UTSW 7 102415364 missense probably damaging 0.97
R4871:Stim1 UTSW 7 102354572 missense probably damaging 1.00
R5110:Stim1 UTSW 7 102268422 missense unknown
R5787:Stim1 UTSW 7 102435440 missense possibly damaging 0.52
R6400:Stim1 UTSW 7 102430950 missense probably null 0.99
R6788:Stim1 UTSW 7 102427291 missense probably damaging 0.99
R7112:Stim1 UTSW 7 102408408 missense probably benign 0.01
R7125:Stim1 UTSW 7 102435534 missense possibly damaging 0.69
R7247:Stim1 UTSW 7 102421532 critical splice donor site probably null
R7650:Stim1 UTSW 7 102428827 missense
R7807:Stim1 UTSW 7 102427141 missense probably damaging 0.99
R8304:Stim1 UTSW 7 102435481 missense possibly damaging 0.55
R8528:Stim1 UTSW 7 102431082 intron probably benign
R8883:Stim1 UTSW 7 102431050 missense unknown
R8921:Stim1 UTSW 7 102421390 missense probably damaging 0.99
R8924:Stim1 UTSW 7 102428807 missense
R9018:Stim1 UTSW 7 102411275 missense probably benign 0.05
R9164:Stim1 UTSW 7 102435419 missense probably benign 0.35
R9396:Stim1 UTSW 7 102415385 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- CTGGTCTCCTACACAAGCTC -3'
(R):5'- TGGACAAGGGCGACACAATC -3'

Sequencing Primer
(F):5'- GTCTCCTACACAAGCTCTGATCCAG -3'
(R):5'- GGGCGACACAATCTCCTC -3'
Posted On 2021-01-18