Incidental Mutation 'R8462:Krt86'
ID656623
Institutional Source Beutler Lab
Gene Symbol Krt86
Ensembl Gene ENSMUSG00000067614
Gene Namekeratin 86
SynonymsKrt2-10, Khb4, Krt2-11, MHb4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R8462 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location101473478-101479986 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101479403 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 436 (V436A)
Ref Sequence ENSEMBL: ENSMUSP00000085365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088049]
Predicted Effect probably benign
Transcript: ENSMUST00000088049
AA Change: V436A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000085365
Gene: ENSMUSG00000067614
AA Change: V436A

DomainStartEndE-ValueType
Pfam:Keratin_2_head 2 102 4.6e-15 PFAM
Filament 105 416 6.92e-148 SMART
low complexity region 420 438 N/A INTRINSIC
low complexity region 469 486 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II keratin protein, which heterodimerizes with type I keratins to form hair and nails. This gene is present in a cluster of related genes and pseudogenes on chromosome 12. Mutations in this gene have been observed in patients with the hair disease monilethrix. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544G11Rik T C 6: 65,953,090 V103A possibly damaging Het
Abcb11 T C 2: 69,274,155 N729S probably benign Het
Ap2a2 T A 7: 141,630,481 N883K probably damaging Het
Atr T C 9: 95,867,526 I464T probably benign Het
Atrn T A 2: 130,935,584 H184Q probably damaging Het
Bmp5 A G 9: 75,839,592 D244G probably benign Het
Celsr2 C A 3: 108,412,851 E882* probably null Het
Cfap58 T A 19: 47,983,650 V673E possibly damaging Het
Chl1 A G 6: 103,729,169 N1155S probably benign Het
Colgalt2 C A 1: 152,503,072 H416Q probably damaging Het
Dab1 C T 4: 104,704,207 L230F probably benign Het
Dixdc1 G T 9: 50,710,779 S84* probably null Het
Dnah8 A G 17: 30,656,629 D475G probably damaging Het
Egr2 T A 10: 67,538,343 N54K probably null Het
Grm3 T C 5: 9,512,365 D495G probably benign Het
Kif1b G A 4: 149,182,340 T1629I probably benign Het
Klf2 A T 8: 72,319,529 N59I probably benign Het
Lrrk2 T C 15: 91,731,477 V838A probably benign Het
Ltbp1 T C 17: 75,313,074 S786P probably damaging Het
Matk C G 10: 81,262,025 R315G probably damaging Het
Meikin T C 11: 54,399,840 V249A probably benign Het
Mrnip A G 11: 50,199,827 R273G probably benign Het
Naf1 GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC 8: 66,860,548 probably benign Het
Nsd1 T A 13: 55,298,376 probably null Het
Pitpnm1 A T 19: 4,105,135 H321L probably benign Het
Plekhm2 T C 4: 141,639,819 Y170C probably damaging Het
Ralgapa1 T C 12: 55,676,518 D2197G possibly damaging Het
Rmdn2 C T 17: 79,670,624 T338M probably damaging Het
Rps10 A G 17: 27,634,234 S54P probably damaging Het
S100a11 T C 3: 93,526,115 S89P probably benign Het
Sh3yl1 T C 12: 30,942,073 Y176H probably damaging Het
Sppl2c G T 11: 104,186,706 A111S possibly damaging Het
Stab2 T C 10: 86,967,734 E317G possibly damaging Het
Stim1 A G 7: 102,427,117 E425G probably damaging Het
Stxbp1 C T 2: 32,817,281 probably null Het
Traf6 G A 2: 101,697,456 R517Q probably damaging Het
Ttn A G 2: 76,974,043 V295A probably damaging Het
Vps45 A T 3: 96,033,779 D383E possibly damaging Het
Zfp984 A G 4: 147,755,339 C352R probably damaging Het
Other mutations in Krt86
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Krt86 APN 15 101476515 missense possibly damaging 0.55
IGL00597:Krt86 APN 15 101476226 missense probably benign 0.01
IGL00776:Krt86 APN 15 101473860 missense probably benign 0.00
IGL00800:Krt86 APN 15 101473860 missense probably benign 0.00
IGL00801:Krt86 APN 15 101473860 missense probably benign 0.00
IGL00857:Krt86 APN 15 101473860 missense probably benign 0.00
IGL00902:Krt86 APN 15 101473860 missense probably benign 0.00
IGL00903:Krt86 APN 15 101473860 missense probably benign 0.00
IGL00939:Krt86 APN 15 101473860 missense probably benign 0.00
IGL00954:Krt86 APN 15 101473860 missense probably benign 0.00
IGL01107:Krt86 APN 15 101475425 missense probably damaging 1.00
IGL01638:Krt86 APN 15 101475472 splice site probably benign
IGL02711:Krt86 APN 15 101473662 missense probably damaging 1.00
BB009:Krt86 UTSW 15 101476592 missense probably damaging 1.00
BB019:Krt86 UTSW 15 101476592 missense probably damaging 1.00
R0046:Krt86 UTSW 15 101477402 missense probably benign 0.00
R0193:Krt86 UTSW 15 101479363 splice site probably benign
R0242:Krt86 UTSW 15 101476573 nonsense probably null
R0242:Krt86 UTSW 15 101476573 nonsense probably null
R0607:Krt86 UTSW 15 101479531 missense unknown
R2139:Krt86 UTSW 15 101473758 missense probably benign 0.11
R4464:Krt86 UTSW 15 101473914 missense probably damaging 0.99
R4985:Krt86 UTSW 15 101477265 missense probably damaging 0.99
R5195:Krt86 UTSW 15 101476933 missense probably benign 0.10
R5587:Krt86 UTSW 15 101473593 missense probably benign 0.01
R5600:Krt86 UTSW 15 101476505 missense probably benign 0.00
R5729:Krt86 UTSW 15 101476548 missense probably benign 0.18
R5876:Krt86 UTSW 15 101476610 missense probably damaging 0.98
R6169:Krt86 UTSW 15 101476289 missense probably damaging 1.00
R6776:Krt86 UTSW 15 101476936 missense probably benign 0.29
R6990:Krt86 UTSW 15 101473833 missense probably benign 0.03
R7111:Krt86 UTSW 15 101476617 missense possibly damaging 0.90
R7932:Krt86 UTSW 15 101476592 missense probably damaging 1.00
Z1177:Krt86 UTSW 15 101476897 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCTCCTGTAACATGCTTTCGG -3'
(R):5'- GCATTGTGACCTCCTAGCAC -3'

Sequencing Primer
(F):5'- ACATGCTTTCGGTTTACTAAAGTCTC -3'
(R):5'- GTGACCTCCTAGCACTTCTTACAG -3'
Posted On2021-01-18