Incidental Mutation 'R8463:Plxna2'
ID 656631
Institutional Source Beutler Lab
Gene Symbol Plxna2
Ensembl Gene ENSMUSG00000026640
Gene Name plexin A2
Synonyms PlexA2, 2810428A13Rik, Plxn2, OCT
MMRRC Submission 067907-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8463 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 194302020-194499177 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 194326354 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 96 (P96L)
Ref Sequence ENSEMBL: ENSMUSP00000027952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027952]
AlphaFold P70207
PDB Structure Plexin A2 / Semaphorin 6A complex [X-RAY DIFFRACTION]
Mouse Plexin A2 extracellular domain [X-RAY DIFFRACTION]
Mouse Plexin A2, extracellular domains 1-4 [X-RAY DIFFRACTION]
Plexin A2 in complex with Semaphorin 6A [X-RAY DIFFRACTION]
Complex of mouse Plexin A2 - Semaphorin 3A - Neuropilin-1 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000027952
AA Change: P96L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027952
Gene: ENSMUSG00000026640
AA Change: P96L

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
Sema 50 492 1.65e-132 SMART
PSI 510 560 8e-12 SMART
PSI 655 702 6.35e-6 SMART
PSI 803 856 1.24e-8 SMART
IPT 857 952 6.36e-21 SMART
IPT 953 1038 1.02e-24 SMART
IPT 1040 1140 1.48e-21 SMART
IPT 1142 1237 8.81e-6 SMART
transmembrane domain 1238 1260 N/A INTRINSIC
Pfam:Plexin_cytopl 1311 1864 1.9e-261 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plexin-A family of semaphorin co-receptors. Semaphorins are a large family of secreted or membrane-bound proteins that mediate repulsive effects on axon pathfinding during nervous system development. A subset of semaphorins are recognized by plexin-A/neuropilin transmembrane receptor complexes, triggering a cellular signal transduction cascade that leads to axon repulsion. This plexin-A family member is thought to transduce signals from semaphorin-3A and -3C. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show abnormal granule cell migration in the adult cerebellum and aberrant projection of mossy fibers in hippocampal slices. Mice homozygous for an ENU-induced allele are smaller and show granule cell migration defects and mild ataxia with incomplete penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 T A 9: 44,192,909 (GRCm39) I146F probably damaging Het
Adcy8 G T 15: 64,792,874 (GRCm39) D27E probably benign Het
Ahnak A G 19: 8,986,113 (GRCm39) I2466V probably benign Het
BC005624 T A 2: 30,871,817 (GRCm39) E19V possibly damaging Het
Bnc2 A T 4: 84,211,608 (GRCm39) F279I probably damaging Het
Bub1 A T 2: 127,659,353 (GRCm39) L335M probably benign Het
Cdkn1c G A 7: 143,014,324 (GRCm39) H41Y possibly damaging Het
Celsr1 G A 15: 85,914,415 (GRCm39) P1186L probably damaging Het
Cnot2 A G 10: 116,353,236 (GRCm39) L75S probably benign Het
Cntn6 A T 6: 104,749,580 (GRCm39) E338D possibly damaging Het
Cracd GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GCGCGAGGCCGAGAGGCAGG 5: 77,004,801 (GRCm39) probably benign Het
Dlg2 G T 7: 91,617,441 (GRCm39) M289I probably benign Het
Dzip1l A T 9: 99,519,875 (GRCm39) D134V possibly damaging Het
Fam171b A G 2: 83,683,801 (GRCm39) Y106C probably damaging Het
Fgd3 T C 13: 49,420,081 (GRCm39) K599E possibly damaging Het
Gabrr2 A T 4: 33,084,375 (GRCm39) I154F probably damaging Het
Gjd2 T A 2: 113,842,053 (GRCm39) E141D probably benign Het
Gmds T C 13: 32,003,906 (GRCm39) N371S probably benign Het
Gp2 C T 7: 119,053,554 (GRCm39) A136T probably damaging Het
Gstm2 A G 3: 107,893,672 (GRCm39) probably null Het
Hnmt T C 2: 23,938,836 (GRCm39) M1V probably null Het
Hydin T C 8: 111,237,553 (GRCm39) V1942A probably benign Het
Krt87 C A 15: 101,332,506 (GRCm39) A236S probably benign Het
Lama3 A T 18: 12,582,896 (GRCm39) H654L probably damaging Het
Lrp2 G A 2: 69,322,250 (GRCm39) T1893M probably damaging Het
Lyg1 A T 1: 37,988,922 (GRCm39) Y99* probably null Het
Mdga1 T C 17: 30,068,703 (GRCm39) D208G probably damaging Het
Mgarp T C 3: 51,296,348 (GRCm39) E218G probably damaging Het
Mif4gd T A 11: 115,499,324 (GRCm39) D186V probably benign Het
Mlec T C 5: 115,288,283 (GRCm39) Y191C probably damaging Het
Mtus1 C A 8: 41,536,271 (GRCm39) V482L probably benign Het
Muc16 T A 9: 18,570,435 (GRCm39) T695S unknown Het
Muc4 A T 16: 32,574,201 (GRCm39) M760L probably benign Het
Mybl2 A T 2: 162,916,638 (GRCm39) S430C probably damaging Het
Nepn A G 10: 52,276,896 (GRCm39) N211D probably benign Het
Nuggc A G 14: 65,851,011 (GRCm39) T294A probably damaging Het
Or51k2 G A 7: 103,595,834 (GRCm39) probably null Het
Or5w16 A T 2: 87,577,437 (GRCm39) E299V probably benign Het
Pcca A G 14: 122,922,526 (GRCm39) probably null Het
Pcdhb13 T G 18: 37,576,287 (GRCm39) S222A possibly damaging Het
Peg10 C CTCA 6: 4,756,453 (GRCm39) probably benign Het
Plppr3 A T 10: 79,703,397 (GRCm39) V29E probably damaging Het
Pop4 A T 7: 37,962,599 (GRCm39) *222R probably null Het
Prss2 T A 6: 41,498,739 (GRCm39) M1K probably null Het
Prss3 C A 6: 41,352,059 (GRCm39) R68L probably benign Het
Recql5 G A 11: 115,787,619 (GRCm39) Q512* probably null Het
Rnf148 A G 6: 23,654,801 (GRCm39) I65T probably benign Het
Scgb1b19 G A 7: 32,987,082 (GRCm39) A78T probably benign Het
Sftpd A G 14: 40,897,583 (GRCm39) probably null Het
Shank1 A G 7: 44,003,605 (GRCm39) R1766G possibly damaging Het
Slc35e2 T C 4: 155,694,615 (GRCm39) L54P probably damaging Het
Smg6 A G 11: 74,820,886 (GRCm39) K386E probably benign Het
Sorcs1 A G 19: 50,248,248 (GRCm39) S393P probably damaging Het
Spen A G 4: 141,249,590 (GRCm39) V66A unknown Het
Tpm1 G T 9: 66,955,512 (GRCm39) A45E probably benign Het
Trmt2a T C 16: 18,069,039 (GRCm39) Y294H probably damaging Het
Txnl4b T C 8: 110,299,430 (GRCm39) V130A possibly damaging Het
Vmn2r14 C A 5: 109,369,340 (GRCm39) V78L probably benign Het
Vmn2r27 A G 6: 124,169,168 (GRCm39) V654A probably damaging Het
Wee2 G T 6: 40,420,914 (GRCm39) M1I probably null Het
Xpnpep3 A G 15: 81,332,672 (GRCm39) K403R probably benign Het
Zranb1 A G 7: 132,551,810 (GRCm39) T154A possibly damaging Het
Other mutations in Plxna2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Plxna2 APN 1 194,326,965 (GRCm39) missense probably damaging 1.00
IGL00332:Plxna2 APN 1 194,472,138 (GRCm39) missense probably damaging 0.98
IGL00392:Plxna2 APN 1 194,482,876 (GRCm39) missense probably damaging 1.00
IGL00432:Plxna2 APN 1 194,326,404 (GRCm39) missense probably benign 0.03
IGL00704:Plxna2 APN 1 194,433,769 (GRCm39) missense probably damaging 0.99
IGL00737:Plxna2 APN 1 194,428,547 (GRCm39) splice site probably benign
IGL01078:Plxna2 APN 1 194,469,001 (GRCm39) unclassified probably benign
IGL01354:Plxna2 APN 1 194,444,743 (GRCm39) missense probably benign 0.02
IGL01432:Plxna2 APN 1 194,326,626 (GRCm39) missense possibly damaging 0.58
IGL01459:Plxna2 APN 1 194,446,878 (GRCm39) missense probably benign 0.00
IGL01525:Plxna2 APN 1 194,394,619 (GRCm39) missense probably benign 0.00
IGL01656:Plxna2 APN 1 194,472,469 (GRCm39) missense possibly damaging 0.52
IGL01825:Plxna2 APN 1 194,471,210 (GRCm39) missense probably damaging 0.98
IGL01862:Plxna2 APN 1 194,326,258 (GRCm39) missense possibly damaging 0.87
IGL01899:Plxna2 APN 1 194,433,796 (GRCm39) missense probably damaging 1.00
IGL01996:Plxna2 APN 1 194,482,084 (GRCm39) missense probably damaging 0.99
IGL02123:Plxna2 APN 1 194,476,691 (GRCm39) missense probably damaging 1.00
IGL02226:Plxna2 APN 1 194,326,732 (GRCm39) missense probably damaging 1.00
IGL02227:Plxna2 APN 1 194,434,397 (GRCm39) missense probably damaging 1.00
IGL02415:Plxna2 APN 1 194,326,272 (GRCm39) missense probably damaging 1.00
IGL02440:Plxna2 APN 1 194,428,458 (GRCm39) missense probably benign 0.10
IGL02545:Plxna2 APN 1 194,468,998 (GRCm39) unclassified probably benign
IGL02553:Plxna2 APN 1 194,433,746 (GRCm39) missense probably benign 0.08
IGL02882:Plxna2 APN 1 194,444,878 (GRCm39) missense probably damaging 1.00
IGL02946:Plxna2 APN 1 194,431,617 (GRCm39) splice site probably benign
IGL03062:Plxna2 APN 1 194,444,858 (GRCm39) missense possibly damaging 0.72
IGL03095:Plxna2 APN 1 194,483,435 (GRCm39) missense probably damaging 1.00
IGL03293:Plxna2 APN 1 194,487,253 (GRCm39) missense probably damaging 0.99
G1Funyon:Plxna2 UTSW 1 194,472,483 (GRCm39) missense probably benign 0.01
PIT4514001:Plxna2 UTSW 1 194,477,245 (GRCm39) missense probably benign 0.00
R0024:Plxna2 UTSW 1 194,326,303 (GRCm39) missense possibly damaging 0.57
R0040:Plxna2 UTSW 1 194,326,204 (GRCm39) missense probably benign 0.13
R0040:Plxna2 UTSW 1 194,326,204 (GRCm39) missense probably benign 0.13
R0063:Plxna2 UTSW 1 194,327,247 (GRCm39) missense probably benign 0.00
R0063:Plxna2 UTSW 1 194,327,247 (GRCm39) missense probably benign 0.00
R0217:Plxna2 UTSW 1 194,326,906 (GRCm39) missense probably damaging 1.00
R0316:Plxna2 UTSW 1 194,326,458 (GRCm39) missense probably damaging 1.00
R0440:Plxna2 UTSW 1 194,326,712 (GRCm39) nonsense probably null
R0505:Plxna2 UTSW 1 194,326,656 (GRCm39) missense possibly damaging 0.93
R0568:Plxna2 UTSW 1 194,433,694 (GRCm39) missense probably benign 0.00
R0669:Plxna2 UTSW 1 194,471,145 (GRCm39) missense probably damaging 0.99
R0674:Plxna2 UTSW 1 194,331,783 (GRCm39) missense probably benign 0.00
R0885:Plxna2 UTSW 1 194,326,864 (GRCm39) missense probably benign
R0898:Plxna2 UTSW 1 194,479,332 (GRCm39) missense probably damaging 1.00
R0940:Plxna2 UTSW 1 194,482,863 (GRCm39) missense probably benign 0.01
R1061:Plxna2 UTSW 1 194,326,401 (GRCm39) missense probably damaging 1.00
R1067:Plxna2 UTSW 1 194,462,818 (GRCm39) splice site probably null
R1222:Plxna2 UTSW 1 194,482,957 (GRCm39) missense probably damaging 1.00
R1345:Plxna2 UTSW 1 194,326,794 (GRCm39) missense probably damaging 1.00
R1363:Plxna2 UTSW 1 194,487,247 (GRCm39) nonsense probably null
R1432:Plxna2 UTSW 1 194,449,771 (GRCm39) missense probably benign 0.10
R1434:Plxna2 UTSW 1 194,433,848 (GRCm39) splice site probably benign
R1597:Plxna2 UTSW 1 194,431,614 (GRCm39) splice site probably benign
R1719:Plxna2 UTSW 1 194,326,678 (GRCm39) missense possibly damaging 0.93
R1778:Plxna2 UTSW 1 194,493,278 (GRCm39) missense probably benign 0.01
R1795:Plxna2 UTSW 1 194,488,611 (GRCm39) missense probably damaging 0.99
R1819:Plxna2 UTSW 1 194,472,494 (GRCm39) missense probably benign 0.03
R1926:Plxna2 UTSW 1 194,444,758 (GRCm39) missense probably benign 0.02
R1966:Plxna2 UTSW 1 194,327,008 (GRCm39) missense possibly damaging 0.91
R1987:Plxna2 UTSW 1 194,326,297 (GRCm39) missense probably damaging 1.00
R1988:Plxna2 UTSW 1 194,326,297 (GRCm39) missense probably damaging 1.00
R2034:Plxna2 UTSW 1 194,462,902 (GRCm39) missense probably benign 0.00
R2131:Plxna2 UTSW 1 194,327,058 (GRCm39) missense probably benign 0.01
R2171:Plxna2 UTSW 1 194,482,925 (GRCm39) missense probably damaging 1.00
R2217:Plxna2 UTSW 1 194,480,056 (GRCm39) missense probably damaging 1.00
R2311:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R2340:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R2342:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R2423:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R2424:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R2425:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R2842:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R2971:Plxna2 UTSW 1 194,480,039 (GRCm39) missense probably damaging 1.00
R3236:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R3731:Plxna2 UTSW 1 194,471,193 (GRCm39) missense probably benign 0.42
R3783:Plxna2 UTSW 1 194,489,829 (GRCm39) missense probably damaging 1.00
R3784:Plxna2 UTSW 1 194,326,925 (GRCm39) missense probably benign
R3787:Plxna2 UTSW 1 194,326,242 (GRCm39) missense probably benign 0.10
R3845:Plxna2 UTSW 1 194,476,098 (GRCm39) missense probably damaging 0.96
R3927:Plxna2 UTSW 1 194,428,465 (GRCm39) missense probably benign 0.02
R3930:Plxna2 UTSW 1 194,477,218 (GRCm39) missense probably benign 0.17
R3964:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R3980:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R4067:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R4120:Plxna2 UTSW 1 194,462,935 (GRCm39) missense probably damaging 1.00
R4231:Plxna2 UTSW 1 194,326,762 (GRCm39) missense probably damaging 1.00
R4257:Plxna2 UTSW 1 194,327,083 (GRCm39) missense probably damaging 1.00
R4396:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R4397:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R4418:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R4444:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R4446:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R4482:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R4487:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R4489:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R4571:Plxna2 UTSW 1 194,493,296 (GRCm39) missense possibly damaging 0.91
R4622:Plxna2 UTSW 1 194,494,458 (GRCm39) missense probably benign
R4623:Plxna2 UTSW 1 194,494,458 (GRCm39) missense probably benign
R4684:Plxna2 UTSW 1 194,444,902 (GRCm39) missense probably benign 0.42
R4688:Plxna2 UTSW 1 194,326,753 (GRCm39) missense probably damaging 1.00
R4855:Plxna2 UTSW 1 194,480,040 (GRCm39) missense probably benign 0.39
R4876:Plxna2 UTSW 1 194,326,083 (GRCm39) missense probably benign 0.02
R5161:Plxna2 UTSW 1 194,433,712 (GRCm39) missense probably benign
R5207:Plxna2 UTSW 1 194,471,207 (GRCm39) missense probably benign 0.19
R5479:Plxna2 UTSW 1 194,476,181 (GRCm39) missense probably benign
R5931:Plxna2 UTSW 1 194,493,178 (GRCm39) missense probably damaging 1.00
R6026:Plxna2 UTSW 1 194,482,122 (GRCm39) missense probably damaging 1.00
R6029:Plxna2 UTSW 1 194,481,883 (GRCm39) missense probably damaging 1.00
R6029:Plxna2 UTSW 1 194,476,735 (GRCm39) missense probably benign 0.00
R6059:Plxna2 UTSW 1 194,493,279 (GRCm39) missense possibly damaging 0.79
R6238:Plxna2 UTSW 1 194,472,504 (GRCm39) missense probably benign 0.01
R6322:Plxna2 UTSW 1 194,436,675 (GRCm39) missense possibly damaging 0.89
R6668:Plxna2 UTSW 1 194,492,396 (GRCm39) missense possibly damaging 0.68
R6709:Plxna2 UTSW 1 194,472,074 (GRCm39) missense probably benign 0.01
R6748:Plxna2 UTSW 1 194,476,490 (GRCm39) splice site probably null
R6838:Plxna2 UTSW 1 194,487,222 (GRCm39) missense possibly damaging 0.90
R6844:Plxna2 UTSW 1 194,476,136 (GRCm39) missense probably benign 0.08
R7069:Plxna2 UTSW 1 194,476,212 (GRCm39) missense possibly damaging 0.51
R7122:Plxna2 UTSW 1 194,326,876 (GRCm39) nonsense probably null
R7145:Plxna2 UTSW 1 194,331,830 (GRCm39) missense probably benign 0.31
R7189:Plxna2 UTSW 1 194,483,366 (GRCm39) missense possibly damaging 0.58
R7207:Plxna2 UTSW 1 194,326,327 (GRCm39) missense probably damaging 1.00
R7232:Plxna2 UTSW 1 194,394,568 (GRCm39) missense probably damaging 1.00
R7234:Plxna2 UTSW 1 194,488,698 (GRCm39) missense probably damaging 0.96
R7246:Plxna2 UTSW 1 194,326,590 (GRCm39) missense possibly damaging 0.74
R7255:Plxna2 UTSW 1 194,434,411 (GRCm39) missense probably benign 0.03
R7283:Plxna2 UTSW 1 194,327,191 (GRCm39) missense probably damaging 0.99
R7288:Plxna2 UTSW 1 194,479,227 (GRCm39) missense probably damaging 1.00
R7361:Plxna2 UTSW 1 194,482,087 (GRCm39) missense probably damaging 1.00
R7424:Plxna2 UTSW 1 194,488,647 (GRCm39) missense probably damaging 0.98
R7501:Plxna2 UTSW 1 194,326,203 (GRCm39) missense possibly damaging 0.95
R7528:Plxna2 UTSW 1 194,494,464 (GRCm39) missense probably damaging 1.00
R7529:Plxna2 UTSW 1 194,326,179 (GRCm39) missense probably benign 0.25
R7532:Plxna2 UTSW 1 194,327,127 (GRCm39) missense probably benign 0.13
R7959:Plxna2 UTSW 1 194,493,270 (GRCm39) missense probably damaging 1.00
R7959:Plxna2 UTSW 1 194,476,172 (GRCm39) frame shift probably null
R7960:Plxna2 UTSW 1 194,476,172 (GRCm39) frame shift probably null
R8261:Plxna2 UTSW 1 194,431,724 (GRCm39) missense probably damaging 1.00
R8301:Plxna2 UTSW 1 194,472,483 (GRCm39) missense probably benign 0.01
R8519:Plxna2 UTSW 1 194,476,266 (GRCm39) missense probably damaging 1.00
R8836:Plxna2 UTSW 1 194,479,243 (GRCm39) missense possibly damaging 0.94
R9010:Plxna2 UTSW 1 194,471,217 (GRCm39) missense possibly damaging 0.95
R9034:Plxna2 UTSW 1 194,476,197 (GRCm39) missense probably damaging 1.00
R9254:Plxna2 UTSW 1 194,492,474 (GRCm39) missense probably damaging 1.00
R9274:Plxna2 UTSW 1 194,471,136 (GRCm39) missense probably damaging 1.00
R9379:Plxna2 UTSW 1 194,492,474 (GRCm39) missense probably damaging 1.00
R9385:Plxna2 UTSW 1 194,431,724 (GRCm39) missense possibly damaging 0.95
R9422:Plxna2 UTSW 1 194,326,730 (GRCm39) missense probably damaging 1.00
R9451:Plxna2 UTSW 1 194,326,692 (GRCm39) missense probably benign 0.05
R9484:Plxna2 UTSW 1 194,327,202 (GRCm39) missense probably damaging 1.00
X0027:Plxna2 UTSW 1 194,326,741 (GRCm39) missense probably damaging 1.00
Z1088:Plxna2 UTSW 1 194,446,847 (GRCm39) missense probably benign 0.06
Z1088:Plxna2 UTSW 1 194,326,749 (GRCm39) missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- GCCTCAGTACAGCACTTTCC -3'
(R):5'- TACATGGTGCCTGTCTTATTGAC -3'

Sequencing Primer
(F):5'- CACTCTGAGAATCGTGACTGGAC -3'
(R):5'- ACTGGACAAGTAGTGTTCCTTC -3'
Posted On 2021-01-18