Mutagenetix > Incidental Mutation

Incidental Mutation 'R8463:Plxna2'

656631

Institutional Source

Beutler Lab

Gene Symbol

Plxna2

Ensembl Gene

ENSMUSG00000026640

Gene Name

plexin A2

Synonyms

2810428A13Rik, OCT, PlexA2, Plxn2

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8463 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

194618218-194816869 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 194644046 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 96 (P96L)

Ref Sequence

ENSEMBL: ENSMUSP00000027952 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027952]

AlphaFold

P70207

PDB Structure

Plexin A2 / Semaphorin 6A complex [X-RAY DIFFRACTION]
Mouse Plexin A2 extracellular domain [X-RAY DIFFRACTION]
Mouse Plexin A2, extracellular domains 1-4 [X-RAY DIFFRACTION]
Plexin A2 in complex with Semaphorin 6A [X-RAY DIFFRACTION]
Complex of mouse Plexin A2 - Semaphorin 3A - Neuropilin-1 [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000027952
AA Change: P96L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000027952
Gene: ENSMUSG00000026640
AA Change: P96L

Domain	Start	End	E-Value	Type
low complexity region	16	29	N/A	INTRINSIC
Sema	50	492	1.65e-132	SMART
PSI	510	560	8e-12	SMART
PSI	655	702	6.35e-6	SMART
PSI	803	856	1.24e-8	SMART
IPT	857	952	6.36e-21	SMART
IPT	953	1038	1.02e-24	SMART
IPT	1040	1140	1.48e-21	SMART
IPT	1142	1237	8.81e-6	SMART
transmembrane domain	1238	1260	N/A	INTRINSIC
Pfam:Plexin_cytopl	1311	1864	1.9e-261	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

98% (64/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plexin-A family of semaphorin co-receptors. Semaphorins are a large family of secreted or membrane-bound proteins that mediate repulsive effects on axon pathfinding during nervous system development. A subset of semaphorins are recognized by plexin-A/neuropilin transmembrane receptor complexes, triggering a cellular signal transduction cascade that leads to axon repulsion. This plexin-A family member is thought to transduce signals from semaphorin-3A and -3C. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show abnormal granule cell migration in the adult cerebellum and aberrant projection of mossy fibers in hippocampal slices. Mice homozygous for an ENU-induced allele are smaller and show granule cell migration defects and mild ataxia with incomplete penetrance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg4	T	A	9: 44,281,612	I146F	probably damaging	Het
Adcy8	G	T	15: 64,921,025	D27E	probably benign	Het
Ahnak	A	G	19: 9,008,749	I2466V	probably benign	Het
BC005624	T	A	2: 30,981,805	E19V	possibly damaging	Het
Bnc2	A	T	4: 84,293,371	F279I	probably damaging	Het
Bub1	A	T	2: 127,817,433	L335M	probably benign	Het
C530008M17Rik	GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG	GCGCGAGGCCGAGAGGCAGG	5: 76,856,954		probably benign	Het
Cdkn1c	G	A	7: 143,460,587	H41Y	possibly damaging	Het
Celsr1	G	A	15: 86,030,214	P1186L	probably damaging	Het
Cnot2	A	G	10: 116,517,331	L75S	probably benign	Het
Cntn6	A	T	6: 104,772,619	E338D	possibly damaging	Het
Dlg2	G	T	7: 91,968,233	M289I	probably benign	Het
Dzip1l	A	T	9: 99,637,822	D134V	possibly damaging	Het
Fam171b	A	G	2: 83,853,457	Y106C	probably damaging	Het
Fgd3	T	C	13: 49,266,605	K599E	possibly damaging	Het
Gabrr2	A	T	4: 33,084,375	I154F	probably damaging	Het
Gjd2	T	A	2: 114,011,572	E141D	probably benign	Het
Gmds	T	C	13: 31,819,923	N371S	probably benign	Het
Gp2	C	T	7: 119,454,331	A136T	probably damaging	Het
Gstm2	A	G	3: 107,986,356		probably null	Het
Hnmt	T	C	2: 24,048,824	M1V	probably null	Het
Hydin	T	C	8: 110,510,921	V1942A	probably benign	Het
Krt87	C	A	15: 101,434,625	A236S	probably benign	Het
Lama3	A	T	18: 12,449,839	H654L	probably damaging	Het
Lrp2	G	A	2: 69,491,906	T1893M	probably damaging	Het
Lyg1	A	T	1: 37,949,841	Y99*	probably null	Het
Mdga1	T	C	17: 29,849,729	D208G	probably damaging	Het
Mgarp	T	C	3: 51,388,927	E218G	probably damaging	Het
Mif4gd	T	A	11: 115,608,498	D186V	probably benign	Het
Mlec	T	C	5: 115,150,224	Y191C	probably damaging	Het
Mtus1	C	A	8: 41,083,234	V482L	probably benign	Het
Muc16	T	A	9: 18,659,139	T695S	unknown	Het
Muc4	A	T	16: 32,752,401	M760L	probably benign	Het
Mybl2	A	T	2: 163,074,718	S430C	probably damaging	Het
Nepn	A	G	10: 52,400,800	N211D	probably benign	Het
Nuggc	A	G	14: 65,613,562	T294A	probably damaging	Het
Olfr1140	A	T	2: 87,747,093	E299V	probably benign	Het
Olfr633	G	A	7: 103,946,627		probably null	Het
Pcca	A	G	14: 122,685,114		probably null	Het
Pcdhb13	T	G	18: 37,443,234	S222A	possibly damaging	Het
Peg10	C	CTCA	6: 4,756,453		probably benign	Het
Plppr3	A	T	10: 79,867,563	V29E	probably damaging	Het
Pop4	A	T	7: 38,263,175	*222R	probably null	Het
Prss2	T	A	6: 41,521,805	M1K	probably null	Het
Prss3	C	A	6: 41,375,125	R68L	probably benign	Het
Recql5	G	A	11: 115,896,793	Q512*	probably null	Het
Rnf148	A	G	6: 23,654,802	I65T	probably benign	Het
Scgb1b19	G	A	7: 33,287,657	A78T	probably benign	Het
Sftpd	A	G	14: 41,175,626		probably null	Het
Shank1	A	G	7: 44,354,181	R1766G	possibly damaging	Het
Slc35e2	T	C	4: 155,610,158	L54P	probably damaging	Het
Smg6	A	G	11: 74,930,060	K386E	probably benign	Het
Sorcs1	A	G	19: 50,259,810	S393P	probably damaging	Het
Spen	A	G	4: 141,522,279	V66A	unknown	Het
Tpm1	G	T	9: 67,048,230	A45E	probably benign	Het
Trmt2a	T	C	16: 18,251,175	Y294H	probably damaging	Het
Txnl4b	T	C	8: 109,572,798	V130A	possibly damaging	Het
Vmn2r14	C	A	5: 109,221,474	V78L	probably benign	Het
Vmn2r27	A	G	6: 124,192,209	V654A	probably damaging	Het
Wee2	G	T	6: 40,443,980	M1I	probably null	Het
Xpnpep3	A	G	15: 81,448,471	K403R	probably benign	Het
Zranb1	A	G	7: 132,950,081	T154A	possibly damaging	Het

Other mutations in Plxna2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00227:Plxna2	APN	1	194644657	missense	probably damaging	1.00
IGL00332:Plxna2	APN	1	194789830	missense	probably damaging	0.98
IGL00392:Plxna2	APN	1	194800568	missense	probably damaging	1.00
IGL00432:Plxna2	APN	1	194644096	missense	probably benign	0.03
IGL00704:Plxna2	APN	1	194751461	missense	probably damaging	0.99
IGL00737:Plxna2	APN	1	194746239	splice site	probably benign
IGL01078:Plxna2	APN	1	194786693	unclassified	probably benign
IGL01354:Plxna2	APN	1	194762435	missense	probably benign	0.02
IGL01432:Plxna2	APN	1	194644318	missense	possibly damaging	0.58
IGL01459:Plxna2	APN	1	194764570	missense	probably benign	0.00
IGL01525:Plxna2	APN	1	194712311	missense	probably benign	0.00
IGL01656:Plxna2	APN	1	194790161	missense	possibly damaging	0.52
IGL01825:Plxna2	APN	1	194788902	missense	probably damaging	0.98
IGL01862:Plxna2	APN	1	194643950	missense	possibly damaging	0.87
IGL01899:Plxna2	APN	1	194751488	missense	probably damaging	1.00
IGL01996:Plxna2	APN	1	194799776	missense	probably damaging	0.99
IGL02123:Plxna2	APN	1	194794383	missense	probably damaging	1.00
IGL02226:Plxna2	APN	1	194644424	missense	probably damaging	1.00
IGL02227:Plxna2	APN	1	194752089	missense	probably damaging	1.00
IGL02415:Plxna2	APN	1	194643964	missense	probably damaging	1.00
IGL02440:Plxna2	APN	1	194746150	missense	probably benign	0.10
IGL02545:Plxna2	APN	1	194786690	unclassified	probably benign
IGL02553:Plxna2	APN	1	194751438	missense	probably benign	0.08
IGL02882:Plxna2	APN	1	194762570	missense	probably damaging	1.00
IGL02946:Plxna2	APN	1	194749309	splice site	probably benign
IGL03062:Plxna2	APN	1	194762550	missense	possibly damaging	0.72
IGL03095:Plxna2	APN	1	194801127	missense	probably damaging	1.00
IGL03293:Plxna2	APN	1	194804945	missense	probably damaging	0.99
G1Funyon:Plxna2	UTSW	1	194790175	missense	probably benign	0.01
PIT4514001:Plxna2	UTSW	1	194794937	missense	probably benign	0.00
R0024:Plxna2	UTSW	1	194643995	missense	possibly damaging	0.57
R0040:Plxna2	UTSW	1	194643896	missense	probably benign	0.13
R0040:Plxna2	UTSW	1	194643896	missense	probably benign	0.13
R0063:Plxna2	UTSW	1	194644939	missense	probably benign	0.00
R0063:Plxna2	UTSW	1	194644939	missense	probably benign	0.00
R0217:Plxna2	UTSW	1	194644598	missense	probably damaging	1.00
R0316:Plxna2	UTSW	1	194644150	missense	probably damaging	1.00
R0440:Plxna2	UTSW	1	194644404	nonsense	probably null
R0505:Plxna2	UTSW	1	194644348	missense	possibly damaging	0.93
R0568:Plxna2	UTSW	1	194751386	missense	probably benign	0.00
R0669:Plxna2	UTSW	1	194788837	missense	probably damaging	0.99
R0674:Plxna2	UTSW	1	194649475	missense	probably benign	0.00
R0885:Plxna2	UTSW	1	194644556	missense	probably benign
R0898:Plxna2	UTSW	1	194797024	missense	probably damaging	1.00
R0940:Plxna2	UTSW	1	194800555	missense	probably benign	0.01
R1061:Plxna2	UTSW	1	194644093	missense	probably damaging	1.00
R1067:Plxna2	UTSW	1	194780510	splice site	probably null
R1222:Plxna2	UTSW	1	194800649	missense	probably damaging	1.00
R1345:Plxna2	UTSW	1	194644486	missense	probably damaging	1.00
R1363:Plxna2	UTSW	1	194804939	nonsense	probably null
R1432:Plxna2	UTSW	1	194767463	missense	probably benign	0.10
R1434:Plxna2	UTSW	1	194751540	splice site	probably benign
R1597:Plxna2	UTSW	1	194749306	splice site	probably benign
R1719:Plxna2	UTSW	1	194644370	missense	possibly damaging	0.93
R1778:Plxna2	UTSW	1	194810970	missense	probably benign	0.01
R1795:Plxna2	UTSW	1	194806303	missense	probably damaging	0.99
R1819:Plxna2	UTSW	1	194790186	missense	probably benign	0.03
R1926:Plxna2	UTSW	1	194762450	missense	probably benign	0.02
R1966:Plxna2	UTSW	1	194644700	missense	possibly damaging	0.91
R1987:Plxna2	UTSW	1	194643989	missense	probably damaging	1.00
R1988:Plxna2	UTSW	1	194643989	missense	probably damaging	1.00
R2034:Plxna2	UTSW	1	194780594	missense	probably benign	0.00
R2131:Plxna2	UTSW	1	194644750	missense	probably benign	0.01
R2171:Plxna2	UTSW	1	194800617	missense	probably damaging	1.00
R2217:Plxna2	UTSW	1	194797748	missense	probably damaging	1.00
R2311:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2340:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2342:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2423:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2424:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2425:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2842:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2971:Plxna2	UTSW	1	194797731	missense	probably damaging	1.00
R3236:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R3731:Plxna2	UTSW	1	194788885	missense	probably benign	0.42
R3783:Plxna2	UTSW	1	194807521	missense	probably damaging	1.00
R3784:Plxna2	UTSW	1	194644617	missense	probably benign
R3787:Plxna2	UTSW	1	194643934	missense	probably benign	0.10
R3845:Plxna2	UTSW	1	194793790	missense	probably damaging	0.96
R3927:Plxna2	UTSW	1	194746157	missense	probably benign	0.02
R3930:Plxna2	UTSW	1	194794910	missense	probably benign	0.17
R3964:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R3980:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4067:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4120:Plxna2	UTSW	1	194780627	missense	probably damaging	1.00
R4231:Plxna2	UTSW	1	194644454	missense	probably damaging	1.00
R4257:Plxna2	UTSW	1	194644775	missense	probably damaging	1.00
R4396:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4397:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4418:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4444:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4446:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4482:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4487:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4489:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4571:Plxna2	UTSW	1	194810988	missense	possibly damaging	0.91
R4622:Plxna2	UTSW	1	194812150	missense	probably benign
R4623:Plxna2	UTSW	1	194812150	missense	probably benign
R4684:Plxna2	UTSW	1	194762594	missense	probably benign	0.42
R4688:Plxna2	UTSW	1	194644445	missense	probably damaging	1.00
R4855:Plxna2	UTSW	1	194797732	missense	probably benign	0.39
R4876:Plxna2	UTSW	1	194643775	missense	probably benign	0.02
R5161:Plxna2	UTSW	1	194751404	missense	probably benign
R5207:Plxna2	UTSW	1	194788899	missense	probably benign	0.19
R5479:Plxna2	UTSW	1	194793873	missense	probably benign
R5931:Plxna2	UTSW	1	194810870	missense	probably damaging	1.00
R6026:Plxna2	UTSW	1	194799814	missense	probably damaging	1.00
R6029:Plxna2	UTSW	1	194794427	missense	probably benign	0.00
R6029:Plxna2	UTSW	1	194799575	missense	probably damaging	1.00
R6059:Plxna2	UTSW	1	194810971	missense	possibly damaging	0.79
R6238:Plxna2	UTSW	1	194790196	missense	probably benign	0.01
R6322:Plxna2	UTSW	1	194754367	missense	possibly damaging	0.89
R6668:Plxna2	UTSW	1	194810088	missense	possibly damaging	0.68
R6709:Plxna2	UTSW	1	194789766	missense	probably benign	0.01
R6748:Plxna2	UTSW	1	194794182	splice site	probably null
R6838:Plxna2	UTSW	1	194804914	missense	possibly damaging	0.90
R6844:Plxna2	UTSW	1	194793828	missense	probably benign	0.08
R7069:Plxna2	UTSW	1	194793904	missense	possibly damaging	0.51
R7122:Plxna2	UTSW	1	194644568	nonsense	probably null
R7145:Plxna2	UTSW	1	194649522	missense	probably benign	0.31
R7189:Plxna2	UTSW	1	194801058	missense	possibly damaging	0.58
R7207:Plxna2	UTSW	1	194644019	missense	probably damaging	1.00
R7232:Plxna2	UTSW	1	194712260	missense	probably damaging	1.00
R7234:Plxna2	UTSW	1	194806390	missense	probably damaging	0.96
R7246:Plxna2	UTSW	1	194644282	missense	possibly damaging	0.74
R7255:Plxna2	UTSW	1	194752103	missense	probably benign	0.03
R7283:Plxna2	UTSW	1	194644883	missense	probably damaging	0.99
R7288:Plxna2	UTSW	1	194796919	missense	probably damaging	1.00
R7361:Plxna2	UTSW	1	194799779	missense	probably damaging	1.00
R7424:Plxna2	UTSW	1	194806339	missense	probably damaging	0.98
R7501:Plxna2	UTSW	1	194643895	missense	possibly damaging	0.95
R7528:Plxna2	UTSW	1	194812156	missense	probably damaging	1.00
R7529:Plxna2	UTSW	1	194643871	missense	probably benign	0.25
R7532:Plxna2	UTSW	1	194644819	missense	probably benign	0.13
R7959:Plxna2	UTSW	1	194793864	frame shift	probably null
R7959:Plxna2	UTSW	1	194810962	missense	probably damaging	1.00
R7960:Plxna2	UTSW	1	194793864	frame shift	probably null
R8261:Plxna2	UTSW	1	194749416	missense	probably damaging	1.00
R8301:Plxna2	UTSW	1	194790175	missense	probably benign	0.01
R8519:Plxna2	UTSW	1	194793958	missense	probably damaging	1.00
R8836:Plxna2	UTSW	1	194796935	missense	possibly damaging	0.94
R9010:Plxna2	UTSW	1	194788909	missense	possibly damaging	0.95
R9034:Plxna2	UTSW	1	194793889	missense	probably damaging	1.00
R9254:Plxna2	UTSW	1	194810166	missense	probably damaging	1.00
R9274:Plxna2	UTSW	1	194788828	missense	probably damaging	1.00
R9379:Plxna2	UTSW	1	194810166	missense	probably damaging	1.00
R9385:Plxna2	UTSW	1	194749416	missense	possibly damaging	0.95
R9422:Plxna2	UTSW	1	194644422	missense	probably damaging	1.00
R9451:Plxna2	UTSW	1	194644384	missense	probably benign	0.05
R9484:Plxna2	UTSW	1	194644894	missense	probably damaging	1.00
X0027:Plxna2	UTSW	1	194644433	missense	probably damaging	1.00
Z1088:Plxna2	UTSW	1	194644441	missense	possibly damaging	0.56
Z1088:Plxna2	UTSW	1	194764539	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- GCCTCAGTACAGCACTTTCC -3'
(R):5'- TACATGGTGCCTGTCTTATTGAC -3'

Sequencing Primer
(F):5'- CACTCTGAGAATCGTGACTGGAC -3'
(R):5'- ACTGGACAAGTAGTGTTCCTTC -3'

Posted On

2021-01-18