Incidental Mutation 'R8463:Prss2'
ID656654
Institutional Source Beutler Lab
Gene Symbol Prss2
Ensembl Gene ENSMUSG00000057163
Gene Nameprotease, serine 2
SynonymsTRYP, Tesp4, Ta, TRY8, Try2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8463 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location41521787-41525079 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to A at 41521805 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000065393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070380]
Predicted Effect probably null
Transcript: ENSMUST00000070380
AA Change: M1K
SMART Domains Protein: ENSMUSP00000065393
Gene: ENSMUSG00000057163
AA Change: M1K

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
Tryp_SPc 23 239 5.29e-106 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the trypsin family of serine proteases and encodes anionic trypsinogen. It is part of a cluster of trypsinogen genes that are located within the T cell receptor beta locus. Enzymes of this family cleave peptide bonds that follow lysine or arginine residues. This protein is found at high levels in pancreatic juice and its upregulation is a characteristic feature of pancreatitis. This protein has also been found to activate pro-urokinase in ovarian tumors, suggesting a function in tumor invasion. In addition, this enzyme is able to cleave across the type II collagen triple helix in rheumatoid arthritis synovitis tissue, potentially participating in the degradation of type II collagen-rich cartilage matrix. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 T A 9: 44,281,612 I146F probably damaging Het
Adcy8 G T 15: 64,921,025 D27E probably benign Het
Ahnak A G 19: 9,008,749 I2466V probably benign Het
BC005624 T A 2: 30,981,805 E19V possibly damaging Het
Bnc2 A T 4: 84,293,371 F279I probably damaging Het
Bub1 A T 2: 127,817,433 L335M probably benign Het
C530008M17Rik GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GCGCGAGGCCGAGAGGCAGG 5: 76,856,954 probably benign Het
Cdkn1c G A 7: 143,460,587 H41Y possibly damaging Het
Celsr1 G A 15: 86,030,214 P1186L probably damaging Het
Cnot2 A G 10: 116,517,331 L75S probably benign Het
Cntn6 A T 6: 104,772,619 E338D possibly damaging Het
Dlg2 G T 7: 91,968,233 M289I probably benign Het
Dzip1l A T 9: 99,637,822 D134V possibly damaging Het
Fam171b A G 2: 83,853,457 Y106C probably damaging Het
Fgd3 T C 13: 49,266,605 K599E possibly damaging Het
Gabrr2 A T 4: 33,084,375 I154F probably damaging Het
Gjd2 T A 2: 114,011,572 E141D probably benign Het
Gmds T C 13: 31,819,923 N371S probably benign Het
Gp2 C T 7: 119,454,331 A136T probably damaging Het
Gstm2 A G 3: 107,986,356 probably null Het
Hnmt T C 2: 24,048,824 M1V probably null Het
Hydin T C 8: 110,510,921 V1942A probably benign Het
Krt87 C A 15: 101,434,625 A236S probably benign Het
Lama3 A T 18: 12,449,839 H654L probably damaging Het
Lrp2 G A 2: 69,491,906 T1893M probably damaging Het
Lyg1 A T 1: 37,949,841 Y99* probably null Het
Mdga1 T C 17: 29,849,729 D208G probably damaging Het
Mgarp T C 3: 51,388,927 E218G probably damaging Het
Mif4gd T A 11: 115,608,498 D186V probably benign Het
Mlec T C 5: 115,150,224 Y191C probably damaging Het
Mtus1 C A 8: 41,083,234 V482L probably benign Het
Muc16 T A 9: 18,659,139 T695S unknown Het
Muc4 A T 16: 32,752,401 M760L probably benign Het
Mybl2 A T 2: 163,074,718 S430C probably damaging Het
Nepn A G 10: 52,400,800 N211D probably benign Het
Nuggc A G 14: 65,613,562 T294A probably damaging Het
Olfr1140 A T 2: 87,747,093 E299V probably benign Het
Olfr633 G A 7: 103,946,627 probably null Het
Pcca A G 14: 122,685,114 probably null Het
Pcdhb13 T G 18: 37,443,234 S222A possibly damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Plppr3 A T 10: 79,867,563 V29E probably damaging Het
Plxna2 C T 1: 194,644,046 P96L probably damaging Het
Pop4 A T 7: 38,263,175 *222R probably null Het
Prss3 C A 6: 41,375,125 R68L probably benign Het
Recql5 G A 11: 115,896,793 Q512* probably null Het
Rnf148 A G 6: 23,654,802 I65T probably benign Het
Scgb1b19 G A 7: 33,287,657 A78T probably benign Het
Sftpd A G 14: 41,175,626 probably null Het
Shank1 A G 7: 44,354,181 R1766G possibly damaging Het
Slc35e2 T C 4: 155,610,158 L54P probably damaging Het
Smg6 A G 11: 74,930,060 K386E probably benign Het
Sorcs1 A G 19: 50,259,810 S393P probably damaging Het
Spen A G 4: 141,522,279 V66A unknown Het
Tpm1 G T 9: 67,048,230 A45E probably benign Het
Trmt2a T C 16: 18,251,175 Y294H probably damaging Het
Txnl4b T C 8: 109,572,798 V130A possibly damaging Het
Vmn2r14 C A 5: 109,221,474 V78L probably benign Het
Vmn2r27 A G 6: 124,192,209 V654A probably damaging Het
Wee2 G T 6: 40,443,980 M1I probably null Het
Xpnpep3 A G 15: 81,448,471 K403R probably benign Het
Zranb1 A G 7: 132,950,081 T154A possibly damaging Het
Other mutations in Prss2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01920:Prss2 APN 6 41524543 missense possibly damaging 0.54
R2009:Prss2 UTSW 6 41523976 missense probably damaging 0.97
R4471:Prss2 UTSW 6 41522846 missense probably damaging 0.97
R5728:Prss2 UTSW 6 41523917 missense probably benign 0.29
R6193:Prss2 UTSW 6 41521820 missense unknown
R6243:Prss2 UTSW 6 41524453 missense probably benign 0.00
R7793:Prss2 UTSW 6 41524952 missense possibly damaging 0.56
Z1177:Prss2 UTSW 6 41523880 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TAGCTCGCCATGTGACAAGG -3'
(R):5'- TTGGCACCAATTAGAATGAAGACTG -3'

Sequencing Primer
(F):5'- GGCACCAAACAGAGCAAAG -3'
(R):5'- CACCAATTAGAATGAAGACTGGAGAC -3'
Posted On2021-01-18