Mutagenetix > Incidental Mutation

Incidental Mutation 'R8463:Cntn6'

656655

Institutional Source

Beutler Lab

Gene Symbol

Cntn6

Ensembl Gene

ENSMUSG00000030092

Gene Name

contactin 6

Synonyms

NB-3

MMRRC Submission

067907-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.128) question?

Stock #

R8463 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

104492790-104863406 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 104772619 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Aspartic acid at position 338 (E338D)

Ref Sequence

ENSEMBL: ENSMUSP00000124025 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089215] [ENSMUST00000161070] [ENSMUST00000162872]

AlphaFold

Q9JMB8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000089215
AA Change: E338D

PolyPhen 2 Score 0.637 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000086623
Gene: ENSMUSG00000030092
AA Change: E338D

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IGc2	41	107	5.24e-7	SMART
IG	129	217	2.28e-7	SMART
IGc2	240	304	4e-12	SMART
IGc2	330	393	4.52e-11	SMART
IGc2	422	486	5.48e-10	SMART
IGc2	512	584	1.44e-4	SMART
FN3	598	684	2.17e-11	SMART
FN3	701	787	8.62e0	SMART
FN3	803	888	9.92e-6	SMART
FN3	903	983	8.17e0	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161070
AA Change: E266D

PolyPhen 2 Score 0.637 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000124714
Gene: ENSMUSG00000030092
AA Change: E266D

Domain	Start	End	E-Value	Type
SCOP:d1cs6a4	4	40	5e-4	SMART
IG	57	145	2.28e-7	SMART
IGc2	168	232	4e-12	SMART
IGc2	258	321	4.52e-11	SMART
IGc2	350	414	5.48e-10	SMART
IGc2	440	512	1.44e-4	SMART
FN3	526	612	2.17e-11	SMART
FN3	629	715	8.62e0	SMART
FN3	731	816	9.92e-6	SMART
FN3	831	911	8.17e0	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000162872
AA Change: E338D

PolyPhen 2 Score 0.637 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000124025
Gene: ENSMUSG00000030092
AA Change: E338D

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IGc2	41	107	5.24e-7	SMART
IG	129	217	2.28e-7	SMART
IGc2	240	304	4e-12	SMART
IGc2	330	393	4.52e-11	SMART
IGc2	422	486	5.48e-10	SMART
IGc2	512	584	1.44e-4	SMART
FN3	598	684	2.17e-11	SMART
FN3	701	787	8.62e0	SMART
FN3	803	888	9.92e-6	SMART
FN3	903	983	8.17e0	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

98% (64/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. It is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for disruption of this gene display impaired coordination without any obvious morphological of physiological abnormalities in the brain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg4	T	A	9: 44,281,612	I146F	probably damaging	Het
Adcy8	G	T	15: 64,921,025	D27E	probably benign	Het
Ahnak	A	G	19: 9,008,749	I2466V	probably benign	Het
BC005624	T	A	2: 30,981,805	E19V	possibly damaging	Het
Bnc2	A	T	4: 84,293,371	F279I	probably damaging	Het
Bub1	A	T	2: 127,817,433	L335M	probably benign	Het
C530008M17Rik	GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG	GCGCGAGGCCGAGAGGCAGG	5: 76,856,954		probably benign	Het
Cdkn1c	G	A	7: 143,460,587	H41Y	possibly damaging	Het
Celsr1	G	A	15: 86,030,214	P1186L	probably damaging	Het
Cnot2	A	G	10: 116,517,331	L75S	probably benign	Het
Dlg2	G	T	7: 91,968,233	M289I	probably benign	Het
Dzip1l	A	T	9: 99,637,822	D134V	possibly damaging	Het
Fam171b	A	G	2: 83,853,457	Y106C	probably damaging	Het
Fgd3	T	C	13: 49,266,605	K599E	possibly damaging	Het
Gabrr2	A	T	4: 33,084,375	I154F	probably damaging	Het
Gjd2	T	A	2: 114,011,572	E141D	probably benign	Het
Gmds	T	C	13: 31,819,923	N371S	probably benign	Het
Gp2	C	T	7: 119,454,331	A136T	probably damaging	Het
Gstm2	A	G	3: 107,986,356		probably null	Het
Hnmt	T	C	2: 24,048,824	M1V	probably null	Het
Hydin	T	C	8: 110,510,921	V1942A	probably benign	Het
Krt87	C	A	15: 101,434,625	A236S	probably benign	Het
Lama3	A	T	18: 12,449,839	H654L	probably damaging	Het
Lrp2	G	A	2: 69,491,906	T1893M	probably damaging	Het
Lyg1	A	T	1: 37,949,841	Y99*	probably null	Het
Mdga1	T	C	17: 29,849,729	D208G	probably damaging	Het
Mgarp	T	C	3: 51,388,927	E218G	probably damaging	Het
Mif4gd	T	A	11: 115,608,498	D186V	probably benign	Het
Mlec	T	C	5: 115,150,224	Y191C	probably damaging	Het
Mtus1	C	A	8: 41,083,234	V482L	probably benign	Het
Muc16	T	A	9: 18,659,139	T695S	unknown	Het
Muc4	A	T	16: 32,752,401	M760L	probably benign	Het
Mybl2	A	T	2: 163,074,718	S430C	probably damaging	Het
Nepn	A	G	10: 52,400,800	N211D	probably benign	Het
Nuggc	A	G	14: 65,613,562	T294A	probably damaging	Het
Olfr1140	A	T	2: 87,747,093	E299V	probably benign	Het
Olfr633	G	A	7: 103,946,627		probably null	Het
Pcca	A	G	14: 122,685,114		probably null	Het
Pcdhb13	T	G	18: 37,443,234	S222A	possibly damaging	Het
Peg10	C	CTCA	6: 4,756,453		probably benign	Het
Plppr3	A	T	10: 79,867,563	V29E	probably damaging	Het
Plxna2	C	T	1: 194,644,046	P96L	probably damaging	Het
Pop4	A	T	7: 38,263,175	*222R	probably null	Het
Prss2	T	A	6: 41,521,805	M1K	probably null	Het
Prss3	C	A	6: 41,375,125	R68L	probably benign	Het
Recql5	G	A	11: 115,896,793	Q512*	probably null	Het
Rnf148	A	G	6: 23,654,802	I65T	probably benign	Het
Scgb1b19	G	A	7: 33,287,657	A78T	probably benign	Het
Sftpd	A	G	14: 41,175,626		probably null	Het
Shank1	A	G	7: 44,354,181	R1766G	possibly damaging	Het
Slc35e2	T	C	4: 155,610,158	L54P	probably damaging	Het
Smg6	A	G	11: 74,930,060	K386E	probably benign	Het
Sorcs1	A	G	19: 50,259,810	S393P	probably damaging	Het
Spen	A	G	4: 141,522,279	V66A	unknown	Het
Tpm1	G	T	9: 67,048,230	A45E	probably benign	Het
Trmt2a	T	C	16: 18,251,175	Y294H	probably damaging	Het
Txnl4b	T	C	8: 109,572,798	V130A	possibly damaging	Het
Vmn2r14	C	A	5: 109,221,474	V78L	probably benign	Het
Vmn2r27	A	G	6: 124,192,209	V654A	probably damaging	Het
Wee2	G	T	6: 40,443,980	M1I	probably null	Het
Xpnpep3	A	G	15: 81,448,471	K403R	probably benign	Het
Zranb1	A	G	7: 132,950,081	T154A	possibly damaging	Het

Other mutations in Cntn6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00547:Cntn6	APN	6	104650400	missense	probably damaging	0.99
IGL01331:Cntn6	APN	6	104774523	missense	probably damaging	1.00
IGL01619:Cntn6	APN	6	104728374	splice site	probably benign
IGL02028:Cntn6	APN	6	104859426	missense	probably damaging	0.99
IGL02420:Cntn6	APN	6	104846142	critical splice donor site	probably null
IGL02557:Cntn6	APN	6	104774535	missense	probably damaging	1.00
IGL03000:Cntn6	APN	6	104804386	missense	probably damaging	1.00
IGL03367:Cntn6	APN	6	104804338	missense	probably damaging	1.00
IGL03383:Cntn6	APN	6	104776457	splice site	probably benign
PIT4366001:Cntn6	UTSW	6	104832537	missense	probably benign	0.05
R0490:Cntn6	UTSW	6	104833918	missense	possibly damaging	0.91
R0583:Cntn6	UTSW	6	104776314	missense	possibly damaging	0.79
R0636:Cntn6	UTSW	6	104863148	missense	probably benign	0.00
R0654:Cntn6	UTSW	6	104776428	missense	probably benign	0.00
R0960:Cntn6	UTSW	6	104774480	missense	probably benign	0.01
R1241:Cntn6	UTSW	6	104832509	missense	probably damaging	1.00
R1385:Cntn6	UTSW	6	104861900	missense	probably benign	0.07
R1401:Cntn6	UTSW	6	104804398	missense	possibly damaging	0.65
R1478:Cntn6	UTSW	6	104776428	missense	probably benign	0.00
R1542:Cntn6	UTSW	6	104848100	missense	probably damaging	1.00
R1593:Cntn6	UTSW	6	104832580	missense	possibly damaging	0.58
R1840:Cntn6	UTSW	6	104774480	missense	probably damaging	1.00
R2066:Cntn6	UTSW	6	104861822	nonsense	probably null
R2097:Cntn6	UTSW	6	104861949	missense	probably damaging	0.99
R2289:Cntn6	UTSW	6	104569028	start gained	probably benign
R2429:Cntn6	UTSW	6	104650565	missense	possibly damaging	0.96
R2967:Cntn6	UTSW	6	104726237	missense	probably benign	0.04
R4009:Cntn6	UTSW	6	104833822	missense	probably damaging	0.98
R4476:Cntn6	UTSW	6	104772561	missense	probably damaging	1.00
R4664:Cntn6	UTSW	6	104728284	missense	probably benign	0.20
R4666:Cntn6	UTSW	6	104728284	missense	probably benign	0.20
R4701:Cntn6	UTSW	6	104804360	missense	probably benign	0.01
R4780:Cntn6	UTSW	6	104845784	missense	probably damaging	1.00
R4854:Cntn6	UTSW	6	104859475	missense	possibly damaging	0.95
R4965:Cntn6	UTSW	6	104774474	missense	probably damaging	0.99
R5051:Cntn6	UTSW	6	104772597	missense	probably damaging	1.00
R5075:Cntn6	UTSW	6	104833030	missense	probably damaging	1.00
R5152:Cntn6	UTSW	6	104569113	intron	probably benign
R5291:Cntn6	UTSW	6	104726135	missense	probably damaging	1.00
R5388:Cntn6	UTSW	6	104832562	missense	probably damaging	1.00
R5852:Cntn6	UTSW	6	104835745	missense	probably damaging	0.97
R5937:Cntn6	UTSW	6	104833103	missense	possibly damaging	0.68
R5980:Cntn6	UTSW	6	104848132	missense	probably damaging	0.98
R6290:Cntn6	UTSW	6	104767890	missense	probably damaging	1.00
R6338:Cntn6	UTSW	6	104726139	missense	probably damaging	1.00
R6396:Cntn6	UTSW	6	104650500	missense	probably damaging	1.00
R6447:Cntn6	UTSW	6	104859448	missense	probably damaging	1.00
R6860:Cntn6	UTSW	6	104861946	missense	possibly damaging	0.95
R6871:Cntn6	UTSW	6	104845758	frame shift	probably null
R7012:Cntn6	UTSW	6	104726262	missense	probably damaging	0.98
R7012:Cntn6	UTSW	6	104774480	missense	probably benign	0.01
R7337:Cntn6	UTSW	6	104650530	missense	probably damaging	0.99
R7658:Cntn6	UTSW	6	104650483	missense	probably benign	0.29
R8133:Cntn6	UTSW	6	104728337	missense	probably benign	0.19
R8909:Cntn6	UTSW	6	104848132	missense	probably benign	0.05
R9232:Cntn6	UTSW	6	104838820	missense	probably damaging	1.00
R9287:Cntn6	UTSW	6	104832510	missense	possibly damaging	0.89
R9454:Cntn6	UTSW	6	104804347	missense	possibly damaging	0.82
R9698:Cntn6	UTSW	6	104833083	nonsense	probably null
X0020:Cntn6	UTSW	6	104767884	missense	probably benign	0.00
Z1177:Cntn6	UTSW	6	104832584	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGTGATGGTTGCCCCTACTAG -3'
(R):5'- TGAAATTTCCTTTCCTGGAGCAC -3'

Sequencing Primer
(F):5'- GAAGTTCACCTGGGCTCAGTTAATC -3'
(R):5'- TTCCTGGAGCACACTGAATG -3'

Posted On

2021-01-18