Incidental Mutation 'R8463:Cntn6'
ID656655
Institutional Source Beutler Lab
Gene Symbol Cntn6
Ensembl Gene ENSMUSG00000030092
Gene Namecontactin 6
SynonymsNB-3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R8463 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location104492790-104863406 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104772619 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 338 (E338D)
Ref Sequence ENSEMBL: ENSMUSP00000124025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089215] [ENSMUST00000161070] [ENSMUST00000162872]
Predicted Effect possibly damaging
Transcript: ENSMUST00000089215
AA Change: E338D

PolyPhen 2 Score 0.637 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000086623
Gene: ENSMUSG00000030092
AA Change: E338D

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 41 107 5.24e-7 SMART
IG 129 217 2.28e-7 SMART
IGc2 240 304 4e-12 SMART
IGc2 330 393 4.52e-11 SMART
IGc2 422 486 5.48e-10 SMART
IGc2 512 584 1.44e-4 SMART
FN3 598 684 2.17e-11 SMART
FN3 701 787 8.62e0 SMART
FN3 803 888 9.92e-6 SMART
FN3 903 983 8.17e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000161070
AA Change: E266D

PolyPhen 2 Score 0.637 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124714
Gene: ENSMUSG00000030092
AA Change: E266D

DomainStartEndE-ValueType
SCOP:d1cs6a4 4 40 5e-4 SMART
IG 57 145 2.28e-7 SMART
IGc2 168 232 4e-12 SMART
IGc2 258 321 4.52e-11 SMART
IGc2 350 414 5.48e-10 SMART
IGc2 440 512 1.44e-4 SMART
FN3 526 612 2.17e-11 SMART
FN3 629 715 8.62e0 SMART
FN3 731 816 9.92e-6 SMART
FN3 831 911 8.17e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000162872
AA Change: E338D

PolyPhen 2 Score 0.637 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124025
Gene: ENSMUSG00000030092
AA Change: E338D

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 41 107 5.24e-7 SMART
IG 129 217 2.28e-7 SMART
IGc2 240 304 4e-12 SMART
IGc2 330 393 4.52e-11 SMART
IGc2 422 486 5.48e-10 SMART
IGc2 512 584 1.44e-4 SMART
FN3 598 684 2.17e-11 SMART
FN3 701 787 8.62e0 SMART
FN3 803 888 9.92e-6 SMART
FN3 903 983 8.17e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. It is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for disruption of this gene display impaired coordination without any obvious morphological of physiological abnormalities in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 T A 9: 44,281,612 I146F probably damaging Het
Adcy8 G T 15: 64,921,025 D27E probably benign Het
Ahnak A G 19: 9,008,749 I2466V probably benign Het
BC005624 T A 2: 30,981,805 E19V possibly damaging Het
Bnc2 A T 4: 84,293,371 F279I probably damaging Het
Bub1 A T 2: 127,817,433 L335M probably benign Het
C530008M17Rik GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GCGCGAGGCCGAGAGGCAGG 5: 76,856,954 probably benign Het
Cdkn1c G A 7: 143,460,587 H41Y possibly damaging Het
Celsr1 G A 15: 86,030,214 P1186L probably damaging Het
Cnot2 A G 10: 116,517,331 L75S probably benign Het
Dlg2 G T 7: 91,968,233 M289I probably benign Het
Dzip1l A T 9: 99,637,822 D134V possibly damaging Het
Fam171b A G 2: 83,853,457 Y106C probably damaging Het
Fgd3 T C 13: 49,266,605 K599E possibly damaging Het
Gabrr2 A T 4: 33,084,375 I154F probably damaging Het
Gjd2 T A 2: 114,011,572 E141D probably benign Het
Gmds T C 13: 31,819,923 N371S probably benign Het
Gp2 C T 7: 119,454,331 A136T probably damaging Het
Gstm2 A G 3: 107,986,356 probably null Het
Hnmt T C 2: 24,048,824 M1V probably null Het
Hydin T C 8: 110,510,921 V1942A probably benign Het
Krt87 C A 15: 101,434,625 A236S probably benign Het
Lama3 A T 18: 12,449,839 H654L probably damaging Het
Lrp2 G A 2: 69,491,906 T1893M probably damaging Het
Lyg1 A T 1: 37,949,841 Y99* probably null Het
Mdga1 T C 17: 29,849,729 D208G probably damaging Het
Mgarp T C 3: 51,388,927 E218G probably damaging Het
Mif4gd T A 11: 115,608,498 D186V probably benign Het
Mlec T C 5: 115,150,224 Y191C probably damaging Het
Mtus1 C A 8: 41,083,234 V482L probably benign Het
Muc16 T A 9: 18,659,139 T695S unknown Het
Muc4 A T 16: 32,752,401 M760L probably benign Het
Mybl2 A T 2: 163,074,718 S430C probably damaging Het
Nepn A G 10: 52,400,800 N211D probably benign Het
Nuggc A G 14: 65,613,562 T294A probably damaging Het
Olfr1140 A T 2: 87,747,093 E299V probably benign Het
Olfr633 G A 7: 103,946,627 probably null Het
Pcca A G 14: 122,685,114 probably null Het
Pcdhb13 T G 18: 37,443,234 S222A possibly damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Plppr3 A T 10: 79,867,563 V29E probably damaging Het
Plxna2 C T 1: 194,644,046 P96L probably damaging Het
Pop4 A T 7: 38,263,175 *222R probably null Het
Prss2 T A 6: 41,521,805 M1K probably null Het
Prss3 C A 6: 41,375,125 R68L probably benign Het
Recql5 G A 11: 115,896,793 Q512* probably null Het
Rnf148 A G 6: 23,654,802 I65T probably benign Het
Scgb1b19 G A 7: 33,287,657 A78T probably benign Het
Sftpd A G 14: 41,175,626 probably null Het
Shank1 A G 7: 44,354,181 R1766G possibly damaging Het
Slc35e2 T C 4: 155,610,158 L54P probably damaging Het
Smg6 A G 11: 74,930,060 K386E probably benign Het
Sorcs1 A G 19: 50,259,810 S393P probably damaging Het
Spen A G 4: 141,522,279 V66A unknown Het
Tpm1 G T 9: 67,048,230 A45E probably benign Het
Trmt2a T C 16: 18,251,175 Y294H probably damaging Het
Txnl4b T C 8: 109,572,798 V130A possibly damaging Het
Vmn2r14 C A 5: 109,221,474 V78L probably benign Het
Vmn2r27 A G 6: 124,192,209 V654A probably damaging Het
Wee2 G T 6: 40,443,980 M1I probably null Het
Xpnpep3 A G 15: 81,448,471 K403R probably benign Het
Zranb1 A G 7: 132,950,081 T154A possibly damaging Het
Other mutations in Cntn6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Cntn6 APN 6 104650400 missense probably damaging 0.99
IGL01331:Cntn6 APN 6 104774523 missense probably damaging 1.00
IGL01619:Cntn6 APN 6 104728374 splice site probably benign
IGL02028:Cntn6 APN 6 104859426 missense probably damaging 0.99
IGL02420:Cntn6 APN 6 104846142 critical splice donor site probably null
IGL02557:Cntn6 APN 6 104774535 missense probably damaging 1.00
IGL03000:Cntn6 APN 6 104804386 missense probably damaging 1.00
IGL03367:Cntn6 APN 6 104804338 missense probably damaging 1.00
IGL03383:Cntn6 APN 6 104776457 splice site probably benign
PIT4366001:Cntn6 UTSW 6 104832537 missense probably benign 0.05
R0490:Cntn6 UTSW 6 104833918 missense possibly damaging 0.91
R0583:Cntn6 UTSW 6 104776314 missense possibly damaging 0.79
R0636:Cntn6 UTSW 6 104863148 missense probably benign 0.00
R0654:Cntn6 UTSW 6 104776428 missense probably benign 0.00
R0960:Cntn6 UTSW 6 104774480 missense probably benign 0.01
R1241:Cntn6 UTSW 6 104832509 missense probably damaging 1.00
R1385:Cntn6 UTSW 6 104861900 missense probably benign 0.07
R1401:Cntn6 UTSW 6 104804398 missense possibly damaging 0.65
R1478:Cntn6 UTSW 6 104776428 missense probably benign 0.00
R1542:Cntn6 UTSW 6 104848100 missense probably damaging 1.00
R1593:Cntn6 UTSW 6 104832580 missense possibly damaging 0.58
R1840:Cntn6 UTSW 6 104774480 missense probably damaging 1.00
R2066:Cntn6 UTSW 6 104861822 nonsense probably null
R2097:Cntn6 UTSW 6 104861949 missense probably damaging 0.99
R2289:Cntn6 UTSW 6 104569028 start gained probably benign
R2429:Cntn6 UTSW 6 104650565 missense possibly damaging 0.96
R2967:Cntn6 UTSW 6 104726237 missense probably benign 0.04
R4009:Cntn6 UTSW 6 104833822 missense probably damaging 0.98
R4476:Cntn6 UTSW 6 104772561 missense probably damaging 1.00
R4664:Cntn6 UTSW 6 104728284 missense probably benign 0.20
R4666:Cntn6 UTSW 6 104728284 missense probably benign 0.20
R4701:Cntn6 UTSW 6 104804360 missense probably benign 0.01
R4780:Cntn6 UTSW 6 104845784 missense probably damaging 1.00
R4854:Cntn6 UTSW 6 104859475 missense possibly damaging 0.95
R4965:Cntn6 UTSW 6 104774474 missense probably damaging 0.99
R5051:Cntn6 UTSW 6 104772597 missense probably damaging 1.00
R5075:Cntn6 UTSW 6 104833030 missense probably damaging 1.00
R5152:Cntn6 UTSW 6 104569113 intron probably benign
R5291:Cntn6 UTSW 6 104726135 missense probably damaging 1.00
R5388:Cntn6 UTSW 6 104832562 missense probably damaging 1.00
R5852:Cntn6 UTSW 6 104835745 missense probably damaging 0.97
R5937:Cntn6 UTSW 6 104833103 missense possibly damaging 0.68
R5980:Cntn6 UTSW 6 104848132 missense probably damaging 0.98
R6290:Cntn6 UTSW 6 104767890 missense probably damaging 1.00
R6338:Cntn6 UTSW 6 104726139 missense probably damaging 1.00
R6396:Cntn6 UTSW 6 104650500 missense probably damaging 1.00
R6447:Cntn6 UTSW 6 104859448 missense probably damaging 1.00
R6860:Cntn6 UTSW 6 104861946 missense possibly damaging 0.95
R6871:Cntn6 UTSW 6 104845758 frame shift probably null
R7012:Cntn6 UTSW 6 104726262 missense probably damaging 0.98
R7012:Cntn6 UTSW 6 104774480 missense probably benign 0.01
R7337:Cntn6 UTSW 6 104650530 missense probably damaging 0.99
R7658:Cntn6 UTSW 6 104650483 missense probably benign 0.29
R8133:Cntn6 UTSW 6 104728337 missense probably benign 0.19
R8909:Cntn6 UTSW 6 104848132 missense probably benign 0.05
X0020:Cntn6 UTSW 6 104767884 missense probably benign 0.00
Z1177:Cntn6 UTSW 6 104832584 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTGATGGTTGCCCCTACTAG -3'
(R):5'- TGAAATTTCCTTTCCTGGAGCAC -3'

Sequencing Primer
(F):5'- GAAGTTCACCTGGGCTCAGTTAATC -3'
(R):5'- TTCCTGGAGCACACTGAATG -3'
Posted On2021-01-18