Incidental Mutation 'R8463:Sftpd'
ID656679
Institutional Source Beutler Lab
Gene Symbol Sftpd
Ensembl Gene ENSMUSG00000021795
Gene Namesurfactant associated protein D
SynonymsSP-D, Sftp4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.202) question?
Stock #R8463 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location41172214-41185149 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 41175626 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000076383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077136]
Predicted Effect probably null
Transcript: ENSMUST00000077136
SMART Domains Protein: ENSMUSP00000076383
Gene: ENSMUSG00000021795

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Collagen 40 96 5.7e-11 PFAM
low complexity region 99 117 N/A INTRINSIC
low complexity region 123 150 N/A INTRINSIC
Pfam:Collagen 162 224 3.3e-12 PFAM
CLECT 252 373 7.38e-23 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the innate immune response, protecting the lungs against inhaled microorganisms and chemicals. The encoded protein may also be involved in surfactant metabolism. [provided by RefSeq, Jul 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit increased pool sizes of alveolar and tissue phosphatidylcholine, accumulation of surfactant lipids, altered phospholipid structure, emphysema, and pulmonary fibrosis and chronic inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 T A 9: 44,281,612 I146F probably damaging Het
Adcy8 G T 15: 64,921,025 D27E probably benign Het
Ahnak A G 19: 9,008,749 I2466V probably benign Het
BC005624 T A 2: 30,981,805 E19V possibly damaging Het
Bnc2 A T 4: 84,293,371 F279I probably damaging Het
Bub1 A T 2: 127,817,433 L335M probably benign Het
C530008M17Rik GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GCGCGAGGCCGAGAGGCAGG 5: 76,856,954 probably benign Het
Cdkn1c G A 7: 143,460,587 H41Y possibly damaging Het
Celsr1 G A 15: 86,030,214 P1186L probably damaging Het
Cnot2 A G 10: 116,517,331 L75S probably benign Het
Cntn6 A T 6: 104,772,619 E338D possibly damaging Het
Dlg2 G T 7: 91,968,233 M289I probably benign Het
Dzip1l A T 9: 99,637,822 D134V possibly damaging Het
Fam171b A G 2: 83,853,457 Y106C probably damaging Het
Fgd3 T C 13: 49,266,605 K599E possibly damaging Het
Gabrr2 A T 4: 33,084,375 I154F probably damaging Het
Gjd2 T A 2: 114,011,572 E141D probably benign Het
Gmds T C 13: 31,819,923 N371S probably benign Het
Gp2 C T 7: 119,454,331 A136T probably damaging Het
Gstm2 A G 3: 107,986,356 probably null Het
Hnmt T C 2: 24,048,824 M1V probably null Het
Hydin T C 8: 110,510,921 V1942A probably benign Het
Krt87 C A 15: 101,434,625 A236S probably benign Het
Lama3 A T 18: 12,449,839 H654L probably damaging Het
Lrp2 G A 2: 69,491,906 T1893M probably damaging Het
Lyg1 A T 1: 37,949,841 Y99* probably null Het
Mdga1 T C 17: 29,849,729 D208G probably damaging Het
Mgarp T C 3: 51,388,927 E218G probably damaging Het
Mif4gd T A 11: 115,608,498 D186V probably benign Het
Mlec T C 5: 115,150,224 Y191C probably damaging Het
Mtus1 C A 8: 41,083,234 V482L probably benign Het
Muc16 T A 9: 18,659,139 T695S unknown Het
Muc4 A T 16: 32,752,401 M760L probably benign Het
Mybl2 A T 2: 163,074,718 S430C probably damaging Het
Nepn A G 10: 52,400,800 N211D probably benign Het
Nuggc A G 14: 65,613,562 T294A probably damaging Het
Olfr1140 A T 2: 87,747,093 E299V probably benign Het
Olfr633 G A 7: 103,946,627 probably null Het
Pcca A G 14: 122,685,114 probably null Het
Pcdhb13 T G 18: 37,443,234 S222A possibly damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Plppr3 A T 10: 79,867,563 V29E probably damaging Het
Plxna2 C T 1: 194,644,046 P96L probably damaging Het
Pop4 A T 7: 38,263,175 *222R probably null Het
Prss2 T A 6: 41,521,805 M1K probably null Het
Prss3 C A 6: 41,375,125 R68L probably benign Het
Recql5 G A 11: 115,896,793 Q512* probably null Het
Rnf148 A G 6: 23,654,802 I65T probably benign Het
Scgb1b19 G A 7: 33,287,657 A78T probably benign Het
Shank1 A G 7: 44,354,181 R1766G possibly damaging Het
Slc35e2 T C 4: 155,610,158 L54P probably damaging Het
Smg6 A G 11: 74,930,060 K386E probably benign Het
Sorcs1 A G 19: 50,259,810 S393P probably damaging Het
Spen A G 4: 141,522,279 V66A unknown Het
Tpm1 G T 9: 67,048,230 A45E probably benign Het
Trmt2a T C 16: 18,251,175 Y294H probably damaging Het
Txnl4b T C 8: 109,572,798 V130A possibly damaging Het
Vmn2r14 C A 5: 109,221,474 V78L probably benign Het
Vmn2r27 A G 6: 124,192,209 V654A probably damaging Het
Wee2 G T 6: 40,443,980 M1I probably null Het
Xpnpep3 A G 15: 81,448,471 K403R probably benign Het
Zranb1 A G 7: 132,950,081 T154A possibly damaging Het
Other mutations in Sftpd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01640:Sftpd APN 14 41172635 missense probably benign 0.32
IGL02252:Sftpd APN 14 41172514 missense probably damaging 1.00
IGL02283:Sftpd APN 14 41172466 missense probably benign 0.01
R1474:Sftpd UTSW 14 41172427 missense probably damaging 0.99
R2302:Sftpd UTSW 14 41172442 missense probably damaging 1.00
R4282:Sftpd UTSW 14 41172580 missense probably benign 0.03
R6945:Sftpd UTSW 14 41174492 missense possibly damaging 0.88
R8069:Sftpd UTSW 14 41172581 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGAAGCCAGCTGTTGTCAC -3'
(R):5'- GGACAGTGAGGTGAAAATCCCC -3'

Sequencing Primer
(F):5'- GTCACCTATTTCCCATGGTAAGATG -3'
(R):5'- TGAGGTGAAAATCCCCAGAAATAAAC -3'
Posted On2021-01-18