Incidental Mutation 'R8464:Erbb4'
ID656695
Institutional Source Beutler Lab
Gene Symbol Erbb4
Ensembl Gene ENSMUSG00000062209
Gene Nameerb-b2 receptor tyrosine kinase 4
SynonymsHer4, ErbB4
Accession Numbers

Ncbi RefSeq: NM_010154.1; MGI:104771

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8464 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location68032186-69108059 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 68309626 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 531 (I531V)
Ref Sequence ENSEMBL: ENSMUSP00000115373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119142] [ENSMUST00000121473] [ENSMUST00000153432]
Predicted Effect probably benign
Transcript: ENSMUST00000119142
AA Change: I531V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112713
Gene: ENSMUSG00000062209
AA Change: I531V

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 5e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 1e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 659 2.32e0 SMART
TyrKc 718 974 7.53e-133 SMART
low complexity region 1007 1023 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121473
AA Change: I531V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114123
Gene: ENSMUSG00000062209
AA Change: I531V

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 1.6e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 5.5e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 659 2.32e0 SMART
TyrKc 718 974 7.53e-133 SMART
low complexity region 1007 1023 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153432
AA Change: I531V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000115373
Gene: ENSMUSG00000062209
AA Change: I531V

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 1.7e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 5.7e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 649 2.98e0 SMART
PDB:2R4B|B 680 732 1e-25 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype Strain: 1929607
Lethality: E10-E11
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Tyr protein kinase family and the epidermal growth factor receptor subfamily. It encodes a single-pass type I membrane protein with multiple cysteine rich domains, a transmembrane domain, a tyrosine kinase domain, a phosphotidylinositol-3 kinase binding site and a PDZ domain binding motif. The protein binds to and is activated by neuregulins and other factors and induces a variety of cellular responses including mitogenesis and differentiation. Multiple proteolytic events allow for the release of a cytoplasmic fragment and an extracellular fragment. Mutations in this gene have been associated with cancer. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit cardiac defects, alterations in hindbrain development, and midgestational lethality. Heterozygotes show schizophrenia-like behavior. Genetically rescued females show mammary defects. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(6) Gene trapped(1)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,659,977 R1344G possibly damaging Het
4933402J07Rik C A 8: 87,589,021 D246E probably damaging Het
Appl1 T A 14: 26,953,028 K191* probably null Het
Bptf T C 11: 107,131,342 D194G probably benign Het
Cacna2d2 T C 9: 107,512,007 V223A probably damaging Het
Ccdc13 T C 9: 121,820,758 K208E probably damaging Het
Chd7 T C 4: 8,811,465 V813A probably benign Het
Chst14 T C 2: 118,927,043 V131A probably benign Het
Ctla4 A G 1: 60,912,527 T72A probably damaging Het
Dnmt3a T C 12: 3,899,635 S531P probably benign Het
Fam151a T A 4: 106,747,905 M488K probably benign Het
Foxa1 C A 12: 57,542,460 A325S probably benign Het
Gm9573 T G 17: 35,622,206 probably benign Het
Ighv8-5 C T 12: 115,067,689 D77N probably benign Het
Itga3 C A 11: 95,062,740 A259S probably benign Het
Kcnh4 T C 11: 100,757,184 N118D probably damaging Het
Kif5b A T 18: 6,225,381 N216K probably damaging Het
Lipo2 C T 19: 33,748,623 M76I probably benign Het
Man2b1 G A 8: 85,094,143 A657T possibly damaging Het
Mms19 A C 19: 41,947,083 D831E probably damaging Het
Myo1a G T 10: 127,718,584 A808S probably benign Het
Myo7b A T 18: 31,962,704 W1834R probably benign Het
Mypn T A 10: 63,131,198 K900* probably null Het
Ogfr AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG 2: 180,595,057 probably benign Het
Olfr1286 A G 2: 111,420,847 Y35H probably damaging Het
Olfr32 G T 2: 90,138,603 H179N possibly damaging Het
Olfr805 A T 10: 129,722,914 I210N possibly damaging Het
Osgepl1 A G 1: 53,318,140 T154A probably damaging Het
Pacsin2 A T 15: 83,379,183 Y82* probably null Het
Pomgnt1 T C 4: 116,152,151 Y104H probably damaging Het
Robo3 T C 9: 37,421,430 S857G probably damaging Het
Scn9a T C 2: 66,566,281 I89M probably damaging Het
Sdhd T C 9: 50,597,131 H145R probably benign Het
Selenov C T 7: 28,288,472 R260Q probably benign Het
Spag6l T C 16: 16,763,034 E483G probably damaging Het
Ssh2 T A 11: 77,454,253 Y1021* probably null Het
Syne2 C T 12: 75,965,772 A2580V probably benign Het
Taf6 T C 5: 138,182,662 E219G probably damaging Het
Ttc27 A G 17: 74,717,930 T7A probably benign Het
Unc80 A G 1: 66,473,264 K111R probably damaging Het
Other mutations in Erbb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Erbb4 APN 1 68071630 nonsense probably null
IGL01020:Erbb4 APN 1 68298449 splice site probably benign
IGL01349:Erbb4 APN 1 68346593 missense probably benign 0.00
IGL01386:Erbb4 APN 1 68343931 missense probably damaging 1.00
IGL01516:Erbb4 APN 1 68328245 nonsense probably null
IGL01536:Erbb4 APN 1 68290282 missense probably benign 0.00
IGL01721:Erbb4 APN 1 68254563 missense possibly damaging 0.46
IGL01832:Erbb4 APN 1 68254566 missense possibly damaging 0.84
IGL02002:Erbb4 APN 1 68080726 missense probably damaging 1.00
IGL02040:Erbb4 APN 1 68042535 missense probably damaging 1.00
IGL02371:Erbb4 APN 1 68290294 missense probably benign 0.00
IGL02399:Erbb4 APN 1 68042437 splice site probably benign
IGL02553:Erbb4 APN 1 68305864 missense probably benign 0.17
IGL03118:Erbb4 APN 1 68042719 missense probably benign 0.11
IGL03329:Erbb4 APN 1 68328122 missense probably benign 0.30
IGL03405:Erbb4 APN 1 68330238 missense probably benign 0.02
earthworm UTSW 1 68250580 missense possibly damaging 0.67
excrescence UTSW 1 68330246 missense probably damaging 1.00
Mole UTSW 1 68560576 missense probably damaging 1.00
P0018:Erbb4 UTSW 1 68071676 missense probably benign 0.05
PIT4480001:Erbb4 UTSW 1 68075543 missense probably damaging 1.00
R0193:Erbb4 UTSW 1 68043960 intron probably benign
R0329:Erbb4 UTSW 1 68298280 splice site probably benign
R0335:Erbb4 UTSW 1 68259259 missense probably benign
R0362:Erbb4 UTSW 1 68330270 missense probably damaging 0.99
R0579:Erbb4 UTSW 1 68042462 missense probably benign 0.17
R0730:Erbb4 UTSW 1 68259290 missense probably damaging 0.98
R1029:Erbb4 UTSW 1 68309614 missense probably damaging 0.96
R1444:Erbb4 UTSW 1 68254600 missense probably damaging 1.00
R1469:Erbb4 UTSW 1 68560682 missense probably damaging 0.99
R1469:Erbb4 UTSW 1 68560682 missense probably damaging 0.99
R1503:Erbb4 UTSW 1 68346546 missense probably benign 0.00
R1523:Erbb4 UTSW 1 68396252 missense possibly damaging 0.95
R1528:Erbb4 UTSW 1 68078582 nonsense probably null
R1604:Erbb4 UTSW 1 68346569 missense possibly damaging 0.88
R1611:Erbb4 UTSW 1 68040388 missense probably damaging 1.00
R1642:Erbb4 UTSW 1 68331234 missense probably damaging 1.00
R1905:Erbb4 UTSW 1 68075410 splice site probably benign
R1929:Erbb4 UTSW 1 68198888 missense probably damaging 0.98
R2046:Erbb4 UTSW 1 68298323 missense probably benign 0.02
R2139:Erbb4 UTSW 1 68346629 missense probably damaging 0.96
R2271:Erbb4 UTSW 1 68198888 missense probably damaging 0.98
R2298:Erbb4 UTSW 1 68042531 missense probably damaging 1.00
R2356:Erbb4 UTSW 1 68078596 missense probably benign 0.00
R3821:Erbb4 UTSW 1 68305913 missense probably damaging 0.97
R4007:Erbb4 UTSW 1 68740401 missense probably damaging 1.00
R4012:Erbb4 UTSW 1 68560576 missense probably damaging 1.00
R4077:Erbb4 UTSW 1 68040337 missense probably benign 0.07
R4196:Erbb4 UTSW 1 68343855 missense possibly damaging 0.90
R4536:Erbb4 UTSW 1 68346622 missense probably damaging 1.00
R4561:Erbb4 UTSW 1 68343921 nonsense probably null
R4642:Erbb4 UTSW 1 68250632 missense probably damaging 1.00
R4737:Erbb4 UTSW 1 68343900 missense probably damaging 0.98
R4739:Erbb4 UTSW 1 68343900 missense probably damaging 0.98
R4780:Erbb4 UTSW 1 68298314 missense probably damaging 1.00
R4801:Erbb4 UTSW 1 68330246 missense probably damaging 1.00
R4802:Erbb4 UTSW 1 68330246 missense probably damaging 1.00
R4811:Erbb4 UTSW 1 68254544 missense probably damaging 1.00
R4832:Erbb4 UTSW 1 68330238 missense probably benign 0.02
R5068:Erbb4 UTSW 1 68043902 splice site probably null
R5546:Erbb4 UTSW 1 68298293 missense probably damaging 0.99
R5755:Erbb4 UTSW 1 68560519 missense possibly damaging 0.96
R6189:Erbb4 UTSW 1 68043916 missense probably benign
R6257:Erbb4 UTSW 1 68396273 missense probably damaging 1.00
R6276:Erbb4 UTSW 1 68560576 missense probably damaging 1.00
R6521:Erbb4 UTSW 1 68042530 missense probably damaging 1.00
R6602:Erbb4 UTSW 1 68370503 missense probably damaging 0.99
R6808:Erbb4 UTSW 1 68040303 missense probably benign 0.00
R7087:Erbb4 UTSW 1 68740491 missense probably null 1.00
R7215:Erbb4 UTSW 1 68339460 missense probably benign
R7356:Erbb4 UTSW 1 68339355 critical splice donor site probably null
R7509:Erbb4 UTSW 1 68250580 missense possibly damaging 0.67
R7593:Erbb4 UTSW 1 68254599 missense probably damaging 0.99
R7743:Erbb4 UTSW 1 68328119 missense probably benign 0.00
R7784:Erbb4 UTSW 1 68075499 missense probably damaging 1.00
R7815:Erbb4 UTSW 1 68042726 missense probably damaging 1.00
R7923:Erbb4 UTSW 1 68259209 missense probably damaging 1.00
R8071:Erbb4 UTSW 1 68396311 missense probably damaging 1.00
R8288:Erbb4 UTSW 1 68298350 missense probably damaging 1.00
R8356:Erbb4 UTSW 1 68071630 missense probably damaging 1.00
R8456:Erbb4 UTSW 1 68071630 missense probably damaging 1.00
R8783:Erbb4 UTSW 1 68040172 missense possibly damaging 0.95
R8830:Erbb4 UTSW 1 68075468 missense probably damaging 1.00
R8881:Erbb4 UTSW 1 68343838 critical splice donor site probably null
X0019:Erbb4 UTSW 1 68073145 missense probably benign 0.00
Z1176:Erbb4 UTSW 1 68298402 frame shift probably null
Z1176:Erbb4 UTSW 1 68328259 nonsense probably null
Z1177:Erbb4 UTSW 1 68259183 frame shift probably null
Z1177:Erbb4 UTSW 1 68290476 missense probably damaging 1.00
Z1177:Erbb4 UTSW 1 68309643 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GCATGCTAGTCAGTGCTAGTC -3'
(R):5'- GGCACCAGCACATTGTAATTATG -3'

Sequencing Primer
(F):5'- TCAGTGCTAGTCTTATTATTTCAAGC -3'
(R):5'- TGGTATGCAACCACCTGT -3'
Posted On2021-01-18