Incidental Mutation 'R8464:Man2b1'
ID656706
Institutional Source Beutler Lab
Gene Symbol Man2b1
Ensembl Gene ENSMUSG00000005142
Gene Namemannosidase 2, alpha B1
Synonymslysosomal alpha-mannosidase
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8464 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location85083270-85098282 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 85094143 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 657 (A657T)
Ref Sequence ENSEMBL: ENSMUSP00000034121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034121]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034121
AA Change: A657T

PolyPhen 2 Score 0.552 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000034121
Gene: ENSMUSG00000005142
AA Change: A657T

DomainStartEndE-ValueType
low complexity region 40 51 N/A INTRINSIC
Pfam:Glyco_hydro_38 64 381 2.7e-96 PFAM
Alpha-mann_mid 386 465 4.25e-23 SMART
Pfam:Glyco_hydro_38C 510 1002 6.2e-106 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that hydrolyzes terminal, non-reducing alpha-D-mannose residues in alpha-D-mannosides. Its activity is necessary for the catabolism of N-linked carbohydrates released during glycoprotein turnover and it is member of family 38 of glycosyl hydrolases. The full length protein is processed in two steps. First, a 49 aa leader sequence is cleaved off and the remainder of the protein is processed into 3 peptides of 70 kDa, 42 kDa (D) and 13/15 kDa (E). Next, the 70 kDa peptide is further processed into three peptides (A, B and C). The A, B and C peptides are disulfide-linked. Defects in this gene have been associated with lysosomal alpha-mannosidosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show urinary oligosaccharide excretion, storage of neutral sugars, oligosaccharide buildup in spleen, kidney, liver, testis and brain, clear vacuoles and axonal spheroids in CNS, PNS and other cell types, behavioralchanges, and enhanced long-term potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,659,977 R1344G possibly damaging Het
4933402J07Rik C A 8: 87,589,021 D246E probably damaging Het
Appl1 T A 14: 26,953,028 K191* probably null Het
Bptf T C 11: 107,131,342 D194G probably benign Het
Cacna2d2 T C 9: 107,512,007 V223A probably damaging Het
Ccdc13 T C 9: 121,820,758 K208E probably damaging Het
Chd7 T C 4: 8,811,465 V813A probably benign Het
Chst14 T C 2: 118,927,043 V131A probably benign Het
Ctla4 A G 1: 60,912,527 T72A probably damaging Het
Dnmt3a T C 12: 3,899,635 S531P probably benign Het
Erbb4 T C 1: 68,309,626 I531V probably benign Het
Fam151a T A 4: 106,747,905 M488K probably benign Het
Foxa1 C A 12: 57,542,460 A325S probably benign Het
Gm9573 T G 17: 35,622,206 probably benign Het
Ighv8-5 C T 12: 115,067,689 D77N probably benign Het
Itga3 C A 11: 95,062,740 A259S probably benign Het
Kcnh4 T C 11: 100,757,184 N118D probably damaging Het
Kif5b A T 18: 6,225,381 N216K probably damaging Het
Lipo2 C T 19: 33,748,623 M76I probably benign Het
Mms19 A C 19: 41,947,083 D831E probably damaging Het
Myo1a G T 10: 127,718,584 A808S probably benign Het
Myo7b A T 18: 31,962,704 W1834R probably benign Het
Mypn T A 10: 63,131,198 K900* probably null Het
Ogfr AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG 2: 180,595,057 probably benign Het
Olfr1286 A G 2: 111,420,847 Y35H probably damaging Het
Olfr32 G T 2: 90,138,603 H179N possibly damaging Het
Olfr805 A T 10: 129,722,914 I210N possibly damaging Het
Osgepl1 A G 1: 53,318,140 T154A probably damaging Het
Pacsin2 A T 15: 83,379,183 Y82* probably null Het
Pomgnt1 T C 4: 116,152,151 Y104H probably damaging Het
Robo3 T C 9: 37,421,430 S857G probably damaging Het
Scn9a T C 2: 66,566,281 I89M probably damaging Het
Sdhd T C 9: 50,597,131 H145R probably benign Het
Selenov C T 7: 28,288,472 R260Q probably benign Het
Spag6l T C 16: 16,763,034 E483G probably damaging Het
Ssh2 T A 11: 77,454,253 Y1021* probably null Het
Syne2 C T 12: 75,965,772 A2580V probably benign Het
Taf6 T C 5: 138,182,662 E219G probably damaging Het
Ttc27 A G 17: 74,717,930 T7A probably benign Het
Unc80 A G 1: 66,473,264 K111R probably damaging Het
Other mutations in Man2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Man2b1 APN 8 85084638 splice site probably null
IGL00671:Man2b1 APN 8 85093938 missense probably damaging 0.98
IGL01538:Man2b1 APN 8 85097430 missense probably benign 0.00
dateline UTSW 8 85084737 missense probably damaging 1.00
greenwich UTSW 8 85085456 nonsense probably null
meridian UTSW 8 85096752 missense probably damaging 1.00
R0018:Man2b1 UTSW 8 85097489 missense probably damaging 1.00
R0302:Man2b1 UTSW 8 85093016 missense probably damaging 1.00
R0574:Man2b1 UTSW 8 85096776 missense probably benign
R0727:Man2b1 UTSW 8 85091526 missense probably damaging 1.00
R0837:Man2b1 UTSW 8 85096829 missense possibly damaging 0.92
R1087:Man2b1 UTSW 8 85095171 missense probably damaging 1.00
R1471:Man2b1 UTSW 8 85086845 missense probably damaging 0.99
R1745:Man2b1 UTSW 8 85093934 missense probably damaging 1.00
R1903:Man2b1 UTSW 8 85086822 missense probably damaging 1.00
R2026:Man2b1 UTSW 8 85095335 missense probably damaging 0.99
R2071:Man2b1 UTSW 8 85085384 missense possibly damaging 0.90
R2120:Man2b1 UTSW 8 85093024 splice site probably benign
R3897:Man2b1 UTSW 8 85096948 splice site probably benign
R3971:Man2b1 UTSW 8 85085391 missense probably damaging 0.98
R3972:Man2b1 UTSW 8 85085391 missense probably damaging 0.98
R4096:Man2b1 UTSW 8 85084737 missense probably damaging 1.00
R4497:Man2b1 UTSW 8 85090936 missense probably benign 0.22
R5183:Man2b1 UTSW 8 85095784 missense probably damaging 1.00
R5191:Man2b1 UTSW 8 85084459 missense probably damaging 1.00
R5644:Man2b1 UTSW 8 85094210 missense possibly damaging 0.61
R6027:Man2b1 UTSW 8 85096752 missense probably damaging 1.00
R6291:Man2b1 UTSW 8 85097046 missense probably benign 0.44
R6341:Man2b1 UTSW 8 85095399 missense probably damaging 1.00
R6467:Man2b1 UTSW 8 85097447 missense possibly damaging 0.91
R6622:Man2b1 UTSW 8 85084479 missense probably damaging 1.00
R6624:Man2b1 UTSW 8 85096853 missense probably benign 0.01
R6631:Man2b1 UTSW 8 85086811 splice site probably null
R6828:Man2b1 UTSW 8 85086919 missense possibly damaging 0.88
R6983:Man2b1 UTSW 8 85091071 splice site probably null
R7159:Man2b1 UTSW 8 85087280 missense probably benign 0.09
R7267:Man2b1 UTSW 8 85087175 missense probably damaging 1.00
R7537:Man2b1 UTSW 8 85090965 nonsense probably null
R7786:Man2b1 UTSW 8 85085456 nonsense probably null
R8022:Man2b1 UTSW 8 85095613 missense probably damaging 1.00
R8069:Man2b1 UTSW 8 85097045 missense probably benign 0.03
R8251:Man2b1 UTSW 8 85095129 missense probably damaging 0.99
R8406:Man2b1 UTSW 8 85096278 missense probably damaging 1.00
R8701:Man2b1 UTSW 8 85095153 missense probably damaging 1.00
R8792:Man2b1 UTSW 8 85095144 nonsense probably null
R8891:Man2b1 UTSW 8 85084455 missense probably damaging 1.00
R8930:Man2b1 UTSW 8 85095393 missense probably damaging 1.00
R8932:Man2b1 UTSW 8 85095393 missense probably damaging 1.00
R8953:Man2b1 UTSW 8 85091910 missense probably benign 0.36
Z1176:Man2b1 UTSW 8 85093938 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACATTTGACTCTGGCACGG -3'
(R):5'- ATGATGAAATAGTTCCCACCCGC -3'

Sequencing Primer
(F):5'- AGATTGAAAACTTGGAACAGAACCTC -3'
(R):5'- CCGCACCTTACATGAGGC -3'
Posted On2021-01-18