Incidental Mutation 'R8464:Ighv8-5'
ID656722
Institutional Source Beutler Lab
Gene Symbol Ighv8-5
Ensembl Gene ENSMUSG00000102364
Gene Nameimmunoglobulin heavy variable V8-5
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock #R8464 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location115067560-115068002 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 115067689 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 77 (D77N)
Ref Sequence ENSEMBL: ENSMUSP00000142292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000194257]
Predicted Effect probably benign
Transcript: ENSMUST00000194257
AA Change: D77N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000142292
Gene: ENSMUSG00000102364
AA Change: D77N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGv 36 118 8.6e-31 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,659,977 R1344G possibly damaging Het
4933402J07Rik C A 8: 87,589,021 D246E probably damaging Het
Appl1 T A 14: 26,953,028 K191* probably null Het
Bptf T C 11: 107,131,342 D194G probably benign Het
Cacna2d2 T C 9: 107,512,007 V223A probably damaging Het
Ccdc13 T C 9: 121,820,758 K208E probably damaging Het
Chd7 T C 4: 8,811,465 V813A probably benign Het
Chst14 T C 2: 118,927,043 V131A probably benign Het
Ctla4 A G 1: 60,912,527 T72A probably damaging Het
Dnmt3a T C 12: 3,899,635 S531P probably benign Het
Erbb4 T C 1: 68,309,626 I531V probably benign Het
Fam151a T A 4: 106,747,905 M488K probably benign Het
Foxa1 C A 12: 57,542,460 A325S probably benign Het
Gm9573 T G 17: 35,622,206 probably benign Het
Itga3 C A 11: 95,062,740 A259S probably benign Het
Kcnh4 T C 11: 100,757,184 N118D probably damaging Het
Kif5b A T 18: 6,225,381 N216K probably damaging Het
Lipo2 C T 19: 33,748,623 M76I probably benign Het
Man2b1 G A 8: 85,094,143 A657T possibly damaging Het
Mms19 A C 19: 41,947,083 D831E probably damaging Het
Myo1a G T 10: 127,718,584 A808S probably benign Het
Myo7b A T 18: 31,962,704 W1834R probably benign Het
Mypn T A 10: 63,131,198 K900* probably null Het
Ogfr AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG 2: 180,595,057 probably benign Het
Olfr1286 A G 2: 111,420,847 Y35H probably damaging Het
Olfr32 G T 2: 90,138,603 H179N possibly damaging Het
Olfr805 A T 10: 129,722,914 I210N possibly damaging Het
Osgepl1 A G 1: 53,318,140 T154A probably damaging Het
Pacsin2 A T 15: 83,379,183 Y82* probably null Het
Pomgnt1 T C 4: 116,152,151 Y104H probably damaging Het
Robo3 T C 9: 37,421,430 S857G probably damaging Het
Scn9a T C 2: 66,566,281 I89M probably damaging Het
Sdhd T C 9: 50,597,131 H145R probably benign Het
Selenov C T 7: 28,288,472 R260Q probably benign Het
Spag6l T C 16: 16,763,034 E483G probably damaging Het
Ssh2 T A 11: 77,454,253 Y1021* probably null Het
Syne2 C T 12: 75,965,772 A2580V probably benign Het
Taf6 T C 5: 138,182,662 E219G probably damaging Het
Ttc27 A G 17: 74,717,930 T7A probably benign Het
Unc80 A G 1: 66,473,264 K111R probably damaging Het
Other mutations in Ighv8-5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Ighv8-5 APN 12 115067574 missense probably damaging 1.00
R0039:Ighv8-5 UTSW 12 115067587 missense possibly damaging 0.49
R2443:Ighv8-5 UTSW 12 115067820 missense probably damaging 1.00
R4910:Ighv8-5 UTSW 12 115067842 missense probably damaging 1.00
R7827:Ighv8-5 UTSW 12 115067638 missense possibly damaging 0.78
R8477:Ighv8-5 UTSW 12 115067580 missense probably benign 0.02
R8823:Ighv8-5 UTSW 12 115067647 missense probably damaging 1.00
Predicted Primers
Posted On2021-01-18