Incidental Mutation 'R8464:Appl1'
ID656723
Institutional Source Beutler Lab
Gene Symbol Appl1
Ensembl Gene ENSMUSG00000040760
Gene Nameadaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1
Synonyms7330406P05Rik, 2900057D21Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.280) question?
Stock #R8464 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location26918988-26971232 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 26953028 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 191 (K191*)
Ref Sequence ENSEMBL: ENSMUSP00000042875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036570]
Predicted Effect probably null
Transcript: ENSMUST00000036570
AA Change: K191*
SMART Domains Protein: ENSMUSP00000042875
Gene: ENSMUSG00000040760
AA Change: K191*

DomainStartEndE-ValueType
Pfam:BAR_3 7 249 2.6e-66 PFAM
PH 278 377 1.4e-3 SMART
low complexity region 425 434 N/A INTRINSIC
Pfam:PID 501 632 6.6e-12 PFAM
low complexity region 645 660 N/A INTRINSIC
low complexity region 679 700 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has been shown to be involved in the regulation of cell proliferation, and in the crosstalk between the adiponectin signalling and insulin signalling pathways. The encoded protein binds many other proteins, including RAB5A, DCC, AKT2, PIK3CA, adiponectin receptors, and proteins of the NuRD/MeCP1 complex. This protein is found associated with endosomal membranes, but can be released by EGF and translocated to the nucleus. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased insulin-induced relaxation and increased insulin-induced ET-1-dependent vasoconstriction when fed a high fat diet. Homozygotes for a second null allele show increased hematocrit and T cell proliferation, and decreased fibroblast cell migration. Homozygotes for a third null allele show hyperactivity, increased body core temperature, and insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,659,977 R1344G possibly damaging Het
4933402J07Rik C A 8: 87,589,021 D246E probably damaging Het
Bptf T C 11: 107,131,342 D194G probably benign Het
Cacna2d2 T C 9: 107,512,007 V223A probably damaging Het
Ccdc13 T C 9: 121,820,758 K208E probably damaging Het
Chd7 T C 4: 8,811,465 V813A probably benign Het
Chst14 T C 2: 118,927,043 V131A probably benign Het
Ctla4 A G 1: 60,912,527 T72A probably damaging Het
Dnmt3a T C 12: 3,899,635 S531P probably benign Het
Erbb4 T C 1: 68,309,626 I531V probably benign Het
Fam151a T A 4: 106,747,905 M488K probably benign Het
Foxa1 C A 12: 57,542,460 A325S probably benign Het
Gm9573 T G 17: 35,622,206 probably benign Het
Ighv8-5 C T 12: 115,067,689 D77N probably benign Het
Itga3 C A 11: 95,062,740 A259S probably benign Het
Kcnh4 T C 11: 100,757,184 N118D probably damaging Het
Kif5b A T 18: 6,225,381 N216K probably damaging Het
Lipo2 C T 19: 33,748,623 M76I probably benign Het
Man2b1 G A 8: 85,094,143 A657T possibly damaging Het
Mms19 A C 19: 41,947,083 D831E probably damaging Het
Myo1a G T 10: 127,718,584 A808S probably benign Het
Myo7b A T 18: 31,962,704 W1834R probably benign Het
Mypn T A 10: 63,131,198 K900* probably null Het
Ogfr AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG 2: 180,595,057 probably benign Het
Olfr1286 A G 2: 111,420,847 Y35H probably damaging Het
Olfr32 G T 2: 90,138,603 H179N possibly damaging Het
Olfr805 A T 10: 129,722,914 I210N possibly damaging Het
Osgepl1 A G 1: 53,318,140 T154A probably damaging Het
Pacsin2 A T 15: 83,379,183 Y82* probably null Het
Pomgnt1 T C 4: 116,152,151 Y104H probably damaging Het
Robo3 T C 9: 37,421,430 S857G probably damaging Het
Scn9a T C 2: 66,566,281 I89M probably damaging Het
Sdhd T C 9: 50,597,131 H145R probably benign Het
Selenov C T 7: 28,288,472 R260Q probably benign Het
Spag6l T C 16: 16,763,034 E483G probably damaging Het
Ssh2 T A 11: 77,454,253 Y1021* probably null Het
Syne2 C T 12: 75,965,772 A2580V probably benign Het
Taf6 T C 5: 138,182,662 E219G probably damaging Het
Ttc27 A G 17: 74,717,930 T7A probably benign Het
Unc80 A G 1: 66,473,264 K111R probably damaging Het
Other mutations in Appl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Appl1 APN 14 26949476 missense possibly damaging 0.89
IGL01615:Appl1 APN 14 26959470 splice site probably benign
IGL01633:Appl1 APN 14 26962838 missense probably damaging 0.99
IGL01945:Appl1 APN 14 26928655 missense possibly damaging 0.80
IGL02210:Appl1 APN 14 26925952 splice site probably benign
IGL02650:Appl1 APN 14 26950708 missense possibly damaging 0.76
IGL02674:Appl1 APN 14 26949461 missense possibly damaging 0.86
IGL02803:Appl1 APN 14 26951516 missense possibly damaging 0.93
R0129:Appl1 UTSW 14 26928643 missense probably damaging 1.00
R0183:Appl1 UTSW 14 26962854 missense probably damaging 1.00
R0323:Appl1 UTSW 14 26942738 missense possibly damaging 0.91
R0411:Appl1 UTSW 14 26940256 missense probably benign
R1213:Appl1 UTSW 14 26943993 missense probably benign 0.27
R1277:Appl1 UTSW 14 26927856 missense possibly damaging 0.87
R1668:Appl1 UTSW 14 26923854 missense probably damaging 1.00
R1856:Appl1 UTSW 14 26927749 missense probably damaging 1.00
R1889:Appl1 UTSW 14 26925513 splice site probably benign
R2145:Appl1 UTSW 14 26949619 missense possibly damaging 0.66
R3720:Appl1 UTSW 14 26927844 missense probably damaging 1.00
R3722:Appl1 UTSW 14 26927844 missense probably damaging 1.00
R3917:Appl1 UTSW 14 26928604 missense probably damaging 1.00
R4700:Appl1 UTSW 14 26925971 missense probably benign 0.00
R5139:Appl1 UTSW 14 26947155 missense probably benign 0.04
R5485:Appl1 UTSW 14 26962866 missense probably damaging 1.00
R5536:Appl1 UTSW 14 26923780 nonsense probably null
R5795:Appl1 UTSW 14 26942816 missense probably benign 0.01
R7044:Appl1 UTSW 14 26928677 missense possibly damaging 0.90
R7318:Appl1 UTSW 14 26963660 missense probably benign 0.01
R7447:Appl1 UTSW 14 26959452 nonsense probably null
R7943:Appl1 UTSW 14 26945568 missense probably benign 0.01
R8110:Appl1 UTSW 14 26927794 nonsense probably null
R8129:Appl1 UTSW 14 26949509 missense possibly damaging 0.87
R8160:Appl1 UTSW 14 26928635 missense probably benign 0.35
R8211:Appl1 UTSW 14 26945598 missense probably benign 0.18
R8239:Appl1 UTSW 14 26964957 missense probably damaging 0.99
R8379:Appl1 UTSW 14 26925415 critical splice donor site probably null
R8699:Appl1 UTSW 14 26940255 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGAAAGTCTTAATTCAATGCATTTCC -3'
(R):5'- CCTTGGAAGATTCTTCTCCACAG -3'

Sequencing Primer
(F):5'- TGCAAGAAAAATCATTTGCCCAATC -3'
(R):5'- GGAAGATTCTTCTCCACAGCTTCTAC -3'
Posted On2021-01-18