Incidental Mutation 'R8464:Kif5b'
ID 656729
Institutional Source Beutler Lab
Gene Symbol Kif5b
Ensembl Gene ENSMUSG00000006740
Gene Name kinesin family member 5B
Synonyms kinesin heavy chain, Khc
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8464 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 6201002-6242174 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 6225381 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 216 (N216K)
Ref Sequence ENSEMBL: ENSMUSP00000130750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025083] [ENSMUST00000163210]
AlphaFold Q61768
Predicted Effect probably damaging
Transcript: ENSMUST00000025083
AA Change: N216K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025083
Gene: ENSMUSG00000006740
AA Change: N216K

DomainStartEndE-ValueType
KISc 6 333 4.48e-172 SMART
low complexity region 341 352 N/A INTRINSIC
coiled coil region 412 564 N/A INTRINSIC
coiled coil region 596 802 N/A INTRINSIC
coiled coil region 825 914 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163210
AA Change: N216K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130750
Gene: ENSMUSG00000006740
AA Change: N216K

DomainStartEndE-ValueType
KISc 6 333 4.48e-172 SMART
low complexity region 341 352 N/A INTRINSIC
coiled coil region 412 564 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos during organogenesis, exhibit growth retardation and fail to turn during gastrulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,659,977 R1344G possibly damaging Het
4933402J07Rik C A 8: 87,589,021 D246E probably damaging Het
Appl1 T A 14: 26,953,028 K191* probably null Het
Bptf T C 11: 107,131,342 D194G probably benign Het
Cacna2d2 T C 9: 107,512,007 V223A probably damaging Het
Ccdc13 T C 9: 121,820,758 K208E probably damaging Het
Chd7 T C 4: 8,811,465 V813A probably benign Het
Chst14 T C 2: 118,927,043 V131A probably benign Het
Ctla4 A G 1: 60,912,527 T72A probably damaging Het
Dnmt3a T C 12: 3,899,635 S531P probably benign Het
Erbb4 T C 1: 68,309,626 I531V probably benign Het
Fam151a T A 4: 106,747,905 M488K probably benign Het
Foxa1 C A 12: 57,542,460 A325S probably benign Het
Gm9573 T G 17: 35,622,206 probably benign Het
Ighv8-5 C T 12: 115,067,689 D77N probably benign Het
Itga3 C A 11: 95,062,740 A259S probably benign Het
Kcnh4 T C 11: 100,757,184 N118D probably damaging Het
Lipo2 C T 19: 33,748,623 M76I probably benign Het
Man2b1 G A 8: 85,094,143 A657T possibly damaging Het
Mms19 A C 19: 41,947,083 D831E probably damaging Het
Myo1a G T 10: 127,718,584 A808S probably benign Het
Myo7b A T 18: 31,962,704 W1834R probably benign Het
Mypn T A 10: 63,131,198 K900* probably null Het
Ogfr AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG 2: 180,595,057 probably benign Het
Olfr1286 A G 2: 111,420,847 Y35H probably damaging Het
Olfr32 G T 2: 90,138,603 H179N possibly damaging Het
Olfr805 A T 10: 129,722,914 I210N possibly damaging Het
Osgepl1 A G 1: 53,318,140 T154A probably damaging Het
Pacsin2 A T 15: 83,379,183 Y82* probably null Het
Pomgnt1 T C 4: 116,152,151 Y104H probably damaging Het
Robo3 T C 9: 37,421,430 S857G probably damaging Het
Scn9a T C 2: 66,566,281 I89M probably damaging Het
Sdhd T C 9: 50,597,131 H145R probably benign Het
Selenov C T 7: 28,288,472 R260Q probably benign Het
Spag6l T C 16: 16,763,034 E483G probably damaging Het
Ssh2 T A 11: 77,454,253 Y1021* probably null Het
Syne2 C T 12: 75,965,772 A2580V probably benign Het
Taf6 T C 5: 138,182,662 E219G probably damaging Het
Ttc27 A G 17: 74,717,930 T7A probably benign Het
Unc80 A G 1: 66,473,264 K111R probably damaging Het
Other mutations in Kif5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00787:Kif5b APN 18 6226973 splice site probably benign
IGL01697:Kif5b APN 18 6226871 missense possibly damaging 0.68
IGL01759:Kif5b APN 18 6225647 missense probably damaging 0.99
IGL01759:Kif5b APN 18 6211019 unclassified probably benign
IGL02027:Kif5b APN 18 6209089 missense possibly damaging 0.81
IGL02553:Kif5b APN 18 6220914 missense probably benign 0.00
IGL03327:Kif5b APN 18 6222767 missense probably damaging 0.96
IGL03346:Kif5b APN 18 6222767 missense probably damaging 0.96
e-enhancer UTSW 18 6213272 missense probably benign 0.00
R0440:Kif5b UTSW 18 6226980 splice site probably benign
R0743:Kif5b UTSW 18 6209192 missense probably damaging 1.00
R1241:Kif5b UTSW 18 6214044 missense probably benign 0.07
R1386:Kif5b UTSW 18 6226383 missense probably damaging 0.99
R1720:Kif5b UTSW 18 6213427 missense probably benign
R1964:Kif5b UTSW 18 6209059 missense possibly damaging 0.85
R2061:Kif5b UTSW 18 6226377 splice site probably null
R2091:Kif5b UTSW 18 6213248 nonsense probably null
R4510:Kif5b UTSW 18 6214011 missense probably benign 0.01
R4511:Kif5b UTSW 18 6214011 missense probably benign 0.01
R4515:Kif5b UTSW 18 6208257 missense probably benign
R4517:Kif5b UTSW 18 6213272 missense probably benign 0.00
R4690:Kif5b UTSW 18 6216759 missense probably benign
R4838:Kif5b UTSW 18 6216869 missense probably damaging 1.00
R4865:Kif5b UTSW 18 6222912 intron probably benign
R4906:Kif5b UTSW 18 6220930 missense probably benign 0.00
R5260:Kif5b UTSW 18 6211058 missense probably damaging 1.00
R5290:Kif5b UTSW 18 6234882 missense probably damaging 1.00
R5517:Kif5b UTSW 18 6220954 missense probably benign 0.00
R5588:Kif5b UTSW 18 6225787 missense probably benign 0.03
R5621:Kif5b UTSW 18 6226883 missense probably benign 0.41
R6269:Kif5b UTSW 18 6223558 missense possibly damaging 0.88
R6377:Kif5b UTSW 18 6212562 missense probably damaging 1.00
R6955:Kif5b UTSW 18 6211070 missense probably benign 0.09
R7256:Kif5b UTSW 18 6225340 missense probably damaging 0.99
R7536:Kif5b UTSW 18 6216235 missense probably benign 0.05
R7892:Kif5b UTSW 18 6212517 missense probably benign 0.02
R7962:Kif5b UTSW 18 6241040 missense probably benign 0.02
R8238:Kif5b UTSW 18 6227619 missense probably damaging 1.00
R8444:Kif5b UTSW 18 6213245 missense probably benign 0.00
R8670:Kif5b UTSW 18 6214631 missense probably benign 0.01
R8691:Kif5b UTSW 18 6225787 missense probably benign 0.38
R8796:Kif5b UTSW 18 6226965 missense probably benign 0.01
R8897:Kif5b UTSW 18 6225437 missense probably damaging 1.00
R8989:Kif5b UTSW 18 6209021 missense probably damaging 0.98
R9003:Kif5b UTSW 18 6224047 missense probably benign 0.33
R9015:Kif5b UTSW 18 6216892 missense probably damaging 0.99
R9047:Kif5b UTSW 18 6208261 missense probably benign
R9369:Kif5b UTSW 18 6223584 missense probably damaging 1.00
R9622:Kif5b UTSW 18 6225672 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAATTCCACAAGTTCTTAAGATGC -3'
(R):5'- GACATGTCGCAGTTACAAGTAAG -3'

Sequencing Primer
(F):5'- GTTCTTAAGATGCAACAATACGTAGC -3'
(R):5'- AGTACTCACCAGGCATGTCTG -3'
Posted On 2021-01-18