Incidental Mutation 'R8465:Olfr1062'
ID 656743
Institutional Source Beutler Lab
Gene Symbol Olfr1062
Ensembl Gene ENSMUSG00000090059
Gene Name olfactory receptor 1062
Synonyms GA_x6K02T2Q125-47892992-47892045, MOR185-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock # R8465 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 86420399-86426749 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 86423631 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 15 (M15K)
Ref Sequence ENSEMBL: ENSMUSP00000149742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105213] [ENSMUST00000217481]
AlphaFold Q7TR71
Predicted Effect probably benign
Transcript: ENSMUST00000105213
AA Change: M15K

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000100848
Gene: ENSMUSG00000090059
AA Change: M15K

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.8e-46 PFAM
Pfam:7tm_1 41 290 2.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217481
AA Change: M15K

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,316,464 L23M possibly damaging Het
Acot6 A T 12: 84,106,441 probably null Het
Adamtsl3 A T 7: 82,598,122 N1429Y probably benign Het
Adk T C 14: 21,103,824 S32P possibly damaging Het
Akap13 A T 7: 75,727,038 M2005L probably benign Het
Atp10a A T 7: 58,828,310 D1367V probably benign Het
Bckdhb A G 9: 83,988,862 I142V probably benign Het
Brap C T 5: 121,679,295 Q322* probably null Het
Carmil3 A T 14: 55,496,848 N401I probably damaging Het
Cdan1 A T 2: 120,728,440 S426T possibly damaging Het
Cdc27 C A 11: 104,517,491 S531I probably benign Het
Cela3a A T 4: 137,403,874 Y184* probably null Het
Cep63 T C 9: 102,613,377 K178R probably benign Het
Cfb G A 17: 34,857,314 Q152* probably null Het
Cnpy2 G A 10: 128,326,175 V106I probably benign Het
Cntn1 GCTGTCTTC GC 15: 92,339,523 probably null Het
Ctc1 G A 11: 69,026,219 G67D probably damaging Het
Cwc27 G T 13: 104,804,264 P196T probably benign Het
Cwc27 C A 13: 104,804,268 L194F possibly damaging Het
Cyp2d12 T G 15: 82,555,177 S11A possibly damaging Het
Ddx55 T A 5: 124,559,121 probably null Het
Dedd2 G T 7: 25,218,906 R75S probably damaging Het
Fat2 G A 11: 55,256,704 S3904F possibly damaging Het
Fibp G A 19: 5,463,187 V177I probably damaging Het
Fsip2 A T 2: 82,979,940 E2201V probably benign Het
Gbp11 C T 5: 105,325,062 D499N probably benign Het
Gfm1 A G 3: 67,431,699 E45G probably damaging Het
Gm884 T A 11: 103,616,121 probably benign Het
H2-D1 A G 17: 35,263,511 Y69C probably damaging Het
Hcar1 A G 5: 123,879,046 F194S probably damaging Het
Heatr4 A T 12: 83,977,933 probably null Het
Kcnd2 G A 6: 21,216,696 C133Y probably damaging Het
Kcnq1 A T 7: 143,425,974 Q619L probably benign Het
Kctd12 T A 14: 102,981,465 R326W probably damaging Het
Kel A G 6: 41,689,538 probably null Het
Lipk A T 19: 34,046,797 I332F probably benign Het
Masp2 A G 4: 148,612,059 D371G possibly damaging Het
Met A G 6: 17,571,810 E1376G probably benign Het
Mup5 A T 4: 61,833,778 I78K probably benign Het
Mynn A T 3: 30,616,641 D526V probably damaging Het
Naip6 G T 13: 100,296,915 T1138N possibly damaging Het
Neurod1 G T 2: 79,454,352 P229Q probably damaging Het
Npepps T G 11: 97,248,259 R162S probably damaging Het
Ntrk3 T A 7: 78,462,883 Q175L probably damaging Het
Obsl1 T C 1: 75,503,388 T310A probably damaging Het
Olfr1079 A G 2: 86,538,387 I176T probably damaging Het
Olfr1288 A T 2: 111,479,080 T99S probably benign Het
Olfr25 A T 9: 38,330,114 I176F possibly damaging Het
Pigf G A 17: 86,997,536 T193I possibly damaging Het
Pkp4 T C 2: 59,342,181 V904A possibly damaging Het
Plekha6 C T 1: 133,270,040 T141M probably damaging Het
Rapgef6 G A 11: 54,691,482 D1407N probably benign Het
Rhobtb3 T C 13: 75,939,622 D82G probably damaging Het
Rims1 T C 1: 22,428,480 N767S possibly damaging Het
Ripor2 T A 13: 24,665,468 probably benign Het
Sec14l4 T A 11: 4,043,948 I296N probably damaging Het
Serpinb12 G T 1: 106,956,612 V363F probably damaging Het
Serpinb9c A G 13: 33,150,033 I342T probably damaging Het
Shmt2 A G 10: 127,520,076 V133A probably damaging Het
Slc30a6 A G 17: 74,415,666 M243V probably benign Het
Slfn2 T A 11: 83,069,661 N155K probably damaging Het
Syne2 A T 12: 75,854,124 D19V possibly damaging Het
Tcl1b3 A T 12: 105,194,477 I116L probably benign Het
Tcp11 A G 17: 28,067,792 I411T probably damaging Het
Tctn1 C T 5: 122,241,796 A560T probably benign Het
Tenm3 C A 8: 48,229,181 Q2471H probably damaging Het
Tnr A G 1: 159,886,075 D691G probably benign Het
Ube3b C T 5: 114,390,390 P150S probably damaging Het
Ugt2b5 T C 5: 87,139,659 I216M possibly damaging Het
Unc5d T A 8: 28,666,849 R789S probably damaging Het
Ush2a G A 1: 188,415,678 G934D probably damaging Het
Usp6nl A T 2: 6,394,541 R70S probably damaging Het
Vmn1r181 T C 7: 23,984,884 I258T possibly damaging Het
Vmn2r15 C A 5: 109,297,436 D41Y probably damaging Het
Vmn2r17 T A 5: 109,452,825 I663N probably damaging Het
Vnn3 C A 10: 23,865,882 Q362K possibly damaging Het
Wdr72 A G 9: 74,152,448 D380G possibly damaging Het
Wfdc10 G A 2: 164,657,260 E97K possibly damaging Het
Xdh A T 17: 73,899,012 C1002* probably null Het
Zscan4e A C 7: 11,307,651 V126G probably damaging Het
Other mutations in Olfr1062
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02040:Olfr1062 APN 2 86422992 missense probably damaging 0.98
IGL02638:Olfr1062 APN 2 86423677 splice site probably null
IGL02863:Olfr1062 APN 2 86423113 missense probably benign 0.44
R0211:Olfr1062 UTSW 2 86423107 missense probably damaging 0.96
R0211:Olfr1062 UTSW 2 86423107 missense probably damaging 0.96
R1486:Olfr1062 UTSW 2 86423481 missense probably damaging 0.99
R2327:Olfr1062 UTSW 2 86422821 nonsense probably null
R3695:Olfr1062 UTSW 2 86423643 missense probably damaging 0.96
R3981:Olfr1062 UTSW 2 86422842 missense probably damaging 1.00
R4156:Olfr1062 UTSW 2 86423200 missense possibly damaging 0.67
R4860:Olfr1062 UTSW 2 86422957 missense probably damaging 1.00
R4860:Olfr1062 UTSW 2 86422957 missense probably damaging 1.00
R5024:Olfr1062 UTSW 2 86423461 missense possibly damaging 0.77
R5351:Olfr1062 UTSW 2 86423266 missense probably damaging 1.00
R5566:Olfr1062 UTSW 2 86423377 nonsense probably null
R5777:Olfr1062 UTSW 2 86423325 missense probably benign 0.00
R6628:Olfr1062 UTSW 2 86423017 missense probably benign 0.02
R7039:Olfr1062 UTSW 2 86422833 missense possibly damaging 0.48
R7159:Olfr1062 UTSW 2 86423612 splice site probably null
R7236:Olfr1062 UTSW 2 86423189 nonsense probably null
R7251:Olfr1062 UTSW 2 86423596 missense probably benign 0.45
R7575:Olfr1062 UTSW 2 86423238 missense probably benign
R7840:Olfr1062 UTSW 2 86423239 missense probably benign 0.00
R8048:Olfr1062 UTSW 2 86423307 missense probably damaging 1.00
R8167:Olfr1062 UTSW 2 86423140 missense probably damaging 1.00
R8672:Olfr1062 UTSW 2 86423632 missense probably benign
R8871:Olfr1062 UTSW 2 86423353 missense probably benign
R9244:Olfr1062 UTSW 2 86423079 missense probably damaging 0.97
R9513:Olfr1062 UTSW 2 86423363 missense probably damaging 1.00
X0065:Olfr1062 UTSW 2 86423122 missense probably benign 0.39
Z1176:Olfr1062 UTSW 2 86423374 missense probably benign 0.07
Z1177:Olfr1062 UTSW 2 86423253 missense probably damaging 1.00
Z1177:Olfr1062 UTSW 2 86423412 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- CAAAGTTGATGACCGCCAGG -3'
(R):5'- TGAAGCCTTAGTACTCTGATGTTTC -3'

Sequencing Primer
(F):5'- CGCCAGGTGTCTGAGGAAG -3'
(R):5'- AAAAAGAGTAAGCATGATTGAACATG -3'
Posted On 2021-01-18