Incidental Mutation 'R8465:Gfm1'
ID 656749
Institutional Source Beutler Lab
Gene Symbol Gfm1
Ensembl Gene ENSMUSG00000027774
Gene Name G elongation factor, mitochondrial 1
Synonyms D3Wsu133e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8465 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 67430096-67476529 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 67431699 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 45 (E45G)
Ref Sequence ENSEMBL: ENSMUSP00000076503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077271]
AlphaFold Q8K0D5
Predicted Effect probably damaging
Transcript: ENSMUST00000077271
AA Change: E45G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000076503
Gene: ENSMUSG00000027774
AA Change: E45G

DomainStartEndE-ValueType
Pfam:GTP_EFTU 45 320 3.5e-65 PFAM
Pfam:GTP_EFTU_D2 366 432 6e-18 PFAM
Pfam:EFG_II 446 520 1.9e-31 PFAM
EFG_IV 522 642 1.64e-47 SMART
EFG_C 644 731 2.16e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Eukaryotes contain two protein translational systems, one in the cytoplasm and one in the mitochondria. Mitochondrial translation is crucial for maintaining mitochondrial function and mutations in this system lead to a breakdown in the respiratory chain-oxidative phosphorylation system and to impaired maintenance of mitochondrial DNA. This gene encodes one of the mitochondrial translation elongation factors. Its role in the regulation of normal mitochondrial function and in different disease states attributed to mitochondrial dysfunction is not known. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,316,464 L23M possibly damaging Het
Acot6 A T 12: 84,106,441 probably null Het
Adamtsl3 A T 7: 82,598,122 N1429Y probably benign Het
Adk T C 14: 21,103,824 S32P possibly damaging Het
Akap13 A T 7: 75,727,038 M2005L probably benign Het
Atp10a A T 7: 58,828,310 D1367V probably benign Het
Bckdhb A G 9: 83,988,862 I142V probably benign Het
Brap C T 5: 121,679,295 Q322* probably null Het
Carmil3 A T 14: 55,496,848 N401I probably damaging Het
Cdan1 A T 2: 120,728,440 S426T possibly damaging Het
Cdc27 C A 11: 104,517,491 S531I probably benign Het
Cela3a A T 4: 137,403,874 Y184* probably null Het
Cep63 T C 9: 102,613,377 K178R probably benign Het
Cfb G A 17: 34,857,314 Q152* probably null Het
Cnpy2 G A 10: 128,326,175 V106I probably benign Het
Cntn1 GCTGTCTTC GC 15: 92,339,523 probably null Het
Ctc1 G A 11: 69,026,219 G67D probably damaging Het
Cwc27 G T 13: 104,804,264 P196T probably benign Het
Cwc27 C A 13: 104,804,268 L194F possibly damaging Het
Cyp2d12 T G 15: 82,555,177 S11A possibly damaging Het
Ddx55 T A 5: 124,559,121 probably null Het
Dedd2 G T 7: 25,218,906 R75S probably damaging Het
Fat2 G A 11: 55,256,704 S3904F possibly damaging Het
Fibp G A 19: 5,463,187 V177I probably damaging Het
Fsip2 A T 2: 82,979,940 E2201V probably benign Het
Gbp11 C T 5: 105,325,062 D499N probably benign Het
Gm884 T A 11: 103,616,121 probably benign Het
H2-D1 A G 17: 35,263,511 Y69C probably damaging Het
Hcar1 A G 5: 123,879,046 F194S probably damaging Het
Heatr4 A T 12: 83,977,933 probably null Het
Kcnd2 G A 6: 21,216,696 C133Y probably damaging Het
Kcnq1 A T 7: 143,425,974 Q619L probably benign Het
Kctd12 T A 14: 102,981,465 R326W probably damaging Het
Kel A G 6: 41,689,538 probably null Het
Lipk A T 19: 34,046,797 I332F probably benign Het
Masp2 A G 4: 148,612,059 D371G possibly damaging Het
Met A G 6: 17,571,810 E1376G probably benign Het
Mup5 A T 4: 61,833,778 I78K probably benign Het
Mynn A T 3: 30,616,641 D526V probably damaging Het
Naip6 G T 13: 100,296,915 T1138N possibly damaging Het
Neurod1 G T 2: 79,454,352 P229Q probably damaging Het
Npepps T G 11: 97,248,259 R162S probably damaging Het
Ntrk3 T A 7: 78,462,883 Q175L probably damaging Het
Obsl1 T C 1: 75,503,388 T310A probably damaging Het
Olfr1062 A T 2: 86,423,631 M15K probably benign Het
Olfr1079 A G 2: 86,538,387 I176T probably damaging Het
Olfr1288 A T 2: 111,479,080 T99S probably benign Het
Olfr25 A T 9: 38,330,114 I176F possibly damaging Het
Pigf G A 17: 86,997,536 T193I possibly damaging Het
Pkp4 T C 2: 59,342,181 V904A possibly damaging Het
Plekha6 C T 1: 133,270,040 T141M probably damaging Het
Rapgef6 G A 11: 54,691,482 D1407N probably benign Het
Rhobtb3 T C 13: 75,939,622 D82G probably damaging Het
Rims1 T C 1: 22,428,480 N767S possibly damaging Het
Ripor2 T A 13: 24,665,468 probably benign Het
Sec14l4 T A 11: 4,043,948 I296N probably damaging Het
Serpinb12 G T 1: 106,956,612 V363F probably damaging Het
Serpinb9c A G 13: 33,150,033 I342T probably damaging Het
Shmt2 A G 10: 127,520,076 V133A probably damaging Het
Slc30a6 A G 17: 74,415,666 M243V probably benign Het
Slfn2 T A 11: 83,069,661 N155K probably damaging Het
Syne2 A T 12: 75,854,124 D19V possibly damaging Het
Tcl1b3 A T 12: 105,194,477 I116L probably benign Het
Tcp11 A G 17: 28,067,792 I411T probably damaging Het
Tctn1 C T 5: 122,241,796 A560T probably benign Het
Tenm3 C A 8: 48,229,181 Q2471H probably damaging Het
Tnr A G 1: 159,886,075 D691G probably benign Het
Ube3b C T 5: 114,390,390 P150S probably damaging Het
Ugt2b5 T C 5: 87,139,659 I216M possibly damaging Het
Unc5d T A 8: 28,666,849 R789S probably damaging Het
Ush2a G A 1: 188,415,678 G934D probably damaging Het
Usp6nl A T 2: 6,394,541 R70S probably damaging Het
Vmn1r181 T C 7: 23,984,884 I258T possibly damaging Het
Vmn2r15 C A 5: 109,297,436 D41Y probably damaging Het
Vmn2r17 T A 5: 109,452,825 I663N probably damaging Het
Vnn3 C A 10: 23,865,882 Q362K possibly damaging Het
Wdr72 A G 9: 74,152,448 D380G possibly damaging Het
Wfdc10 G A 2: 164,657,260 E97K possibly damaging Het
Xdh A T 17: 73,899,012 C1002* probably null Het
Zscan4e A C 7: 11,307,651 V126G probably damaging Het
Other mutations in Gfm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Gfm1 APN 3 67438560 missense possibly damaging 0.79
IGL01377:Gfm1 APN 3 67474753 missense probably damaging 1.00
IGL01397:Gfm1 APN 3 67443658 missense probably benign 0.09
IGL01738:Gfm1 APN 3 67456661 missense probably benign 0.15
IGL02679:Gfm1 APN 3 67474767 missense possibly damaging 0.56
IGL03271:Gfm1 APN 3 67474743 missense probably damaging 1.00
R0389:Gfm1 UTSW 3 67457918 missense probably benign 0.00
R0815:Gfm1 UTSW 3 67474595 missense probably damaging 1.00
R0863:Gfm1 UTSW 3 67474595 missense probably damaging 1.00
R1626:Gfm1 UTSW 3 67438644 missense probably damaging 1.00
R1843:Gfm1 UTSW 3 67435610 missense probably damaging 1.00
R1931:Gfm1 UTSW 3 67456585 missense probably benign 0.44
R2097:Gfm1 UTSW 3 67449746 missense probably damaging 0.97
R2149:Gfm1 UTSW 3 67474560 missense probably damaging 1.00
R2337:Gfm1 UTSW 3 67435514 missense probably damaging 1.00
R3739:Gfm1 UTSW 3 67456700 missense probably damaging 1.00
R4193:Gfm1 UTSW 3 67431720 missense probably damaging 1.00
R4661:Gfm1 UTSW 3 67433398 missense probably damaging 1.00
R5023:Gfm1 UTSW 3 67473544 missense probably damaging 1.00
R5057:Gfm1 UTSW 3 67473544 missense probably damaging 1.00
R5503:Gfm1 UTSW 3 67453727 critical splice donor site probably null
R5692:Gfm1 UTSW 3 67435622 missense probably damaging 1.00
R5771:Gfm1 UTSW 3 67435562 missense probably benign 0.11
R6232:Gfm1 UTSW 3 67467882 missense possibly damaging 0.52
R6234:Gfm1 UTSW 3 67435514 missense probably damaging 1.00
R6514:Gfm1 UTSW 3 67473546 missense probably benign
R6911:Gfm1 UTSW 3 67451303 missense possibly damaging 0.83
R7295:Gfm1 UTSW 3 67440181 missense probably benign 0.30
R7899:Gfm1 UTSW 3 67473527 missense probably benign 0.10
R8321:Gfm1 UTSW 3 67430261 missense probably benign
R8473:Gfm1 UTSW 3 67453718 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TAAATCCAGGGCTCCTTAGATAATACG -3'
(R):5'- CGACCAGTTTTCATCCTAAAACAAG -3'

Sequencing Primer
(F):5'- CTCCTTAGATAATACGGAGGTTGAG -3'
(R):5'- CATCCTAAAACAAGGTTTTCTGAAAC -3'
Posted On 2021-01-18