Incidental Mutation 'R8465:Met'
ID 656760
Institutional Source Beutler Lab
Gene Symbol Met
Ensembl Gene ENSMUSG00000009376
Gene Name met proto-oncogene
Synonyms Par4, HGF receptor, c-Met
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8465 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 17463800-17573980 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 17571810 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1376 (E1376G)
Ref Sequence ENSEMBL: ENSMUSP00000111103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080469] [ENSMUST00000115442] [ENSMUST00000115443]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000080469
AA Change: E1376G

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000079324
Gene: ENSMUSG00000009376
AA Change: E1376G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 52 495 4.5e-134 SMART
PSI 518 561 1.18e-9 SMART
IPT 561 654 9.43e-15 SMART
IPT 655 738 4.16e-25 SMART
IPT 740 835 3.38e-16 SMART
IPT 837 933 4.08e-10 SMART
TyrKc 1076 1335 7.65e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115442
AA Change: E1376G

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000111102
Gene: ENSMUSG00000009376
AA Change: E1376G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 52 495 4.5e-134 SMART
PSI 518 561 1.18e-9 SMART
IPT 561 654 9.43e-15 SMART
IPT 655 738 4.16e-25 SMART
IPT 740 835 3.38e-16 SMART
IPT 837 933 4.08e-10 SMART
TyrKc 1076 1335 7.65e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115443
AA Change: E1376G

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000111103
Gene: ENSMUSG00000009376
AA Change: E1376G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 52 495 4.5e-134 SMART
PSI 518 561 1.18e-9 SMART
IPT 561 654 9.43e-15 SMART
IPT 655 738 4.16e-25 SMART
IPT 740 835 3.38e-16 SMART
IPT 837 933 4.08e-10 SMART
TyrKc 1076 1335 7.65e-134 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the receptor tyrosine kinase family of proteins and the product of the proto-oncogene MET. The encoded preproprotein is proteolytically processed to generate alpha and beta subunits that are linked via disulfide bonds to form the mature receptor. Further processing of the beta subunit results in the formation of the M10 peptide, which has been shown to reduce lung fibrosis. Binding of its ligand, hepatocyte growth factor, induces dimerization and activation of the receptor, which plays a role in cellular survival, embryogenesis, and cellular migration and invasion. Mutations in this gene are associated with papillary renal cell carcinoma, hepatocellular carcinoma, and various head and neck cancers. Amplification and overexpression of this gene are also associated with multiple human cancers. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous null mutants exhibit impaired embryonic development resulting in death. Abnormalities observed in various mutant lines include muscle agenesis due to impaired migration of myogenic precursors, defects of motor axon migration, and placental andliver defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,316,464 L23M possibly damaging Het
Acot6 A T 12: 84,106,441 probably null Het
Adamtsl3 A T 7: 82,598,122 N1429Y probably benign Het
Adk T C 14: 21,103,824 S32P possibly damaging Het
Akap13 A T 7: 75,727,038 M2005L probably benign Het
Atp10a A T 7: 58,828,310 D1367V probably benign Het
Bckdhb A G 9: 83,988,862 I142V probably benign Het
Brap C T 5: 121,679,295 Q322* probably null Het
Carmil3 A T 14: 55,496,848 N401I probably damaging Het
Cdan1 A T 2: 120,728,440 S426T possibly damaging Het
Cdc27 C A 11: 104,517,491 S531I probably benign Het
Cela3a A T 4: 137,403,874 Y184* probably null Het
Cep63 T C 9: 102,613,377 K178R probably benign Het
Cfb G A 17: 34,857,314 Q152* probably null Het
Cnpy2 G A 10: 128,326,175 V106I probably benign Het
Cntn1 GCTGTCTTC GC 15: 92,339,523 probably null Het
Ctc1 G A 11: 69,026,219 G67D probably damaging Het
Cwc27 G T 13: 104,804,264 P196T probably benign Het
Cwc27 C A 13: 104,804,268 L194F possibly damaging Het
Cyp2d12 T G 15: 82,555,177 S11A possibly damaging Het
Ddx55 T A 5: 124,559,121 probably null Het
Dedd2 G T 7: 25,218,906 R75S probably damaging Het
Fat2 G A 11: 55,256,704 S3904F possibly damaging Het
Fibp G A 19: 5,463,187 V177I probably damaging Het
Fsip2 A T 2: 82,979,940 E2201V probably benign Het
Gbp11 C T 5: 105,325,062 D499N probably benign Het
Gfm1 A G 3: 67,431,699 E45G probably damaging Het
Gm884 T A 11: 103,616,121 probably benign Het
H2-D1 A G 17: 35,263,511 Y69C probably damaging Het
Hcar1 A G 5: 123,879,046 F194S probably damaging Het
Heatr4 A T 12: 83,977,933 probably null Het
Kcnd2 G A 6: 21,216,696 C133Y probably damaging Het
Kcnq1 A T 7: 143,425,974 Q619L probably benign Het
Kctd12 T A 14: 102,981,465 R326W probably damaging Het
Kel A G 6: 41,689,538 probably null Het
Lipk A T 19: 34,046,797 I332F probably benign Het
Masp2 A G 4: 148,612,059 D371G possibly damaging Het
Mup5 A T 4: 61,833,778 I78K probably benign Het
Mynn A T 3: 30,616,641 D526V probably damaging Het
Naip6 G T 13: 100,296,915 T1138N possibly damaging Het
Neurod1 G T 2: 79,454,352 P229Q probably damaging Het
Npepps T G 11: 97,248,259 R162S probably damaging Het
Ntrk3 T A 7: 78,462,883 Q175L probably damaging Het
Obsl1 T C 1: 75,503,388 T310A probably damaging Het
Olfr1062 A T 2: 86,423,631 M15K probably benign Het
Olfr1079 A G 2: 86,538,387 I176T probably damaging Het
Olfr1288 A T 2: 111,479,080 T99S probably benign Het
Olfr25 A T 9: 38,330,114 I176F possibly damaging Het
Pigf G A 17: 86,997,536 T193I possibly damaging Het
Pkp4 T C 2: 59,342,181 V904A possibly damaging Het
Plekha6 C T 1: 133,270,040 T141M probably damaging Het
Rapgef6 G A 11: 54,691,482 D1407N probably benign Het
Rhobtb3 T C 13: 75,939,622 D82G probably damaging Het
Rims1 T C 1: 22,428,480 N767S possibly damaging Het
Ripor2 T A 13: 24,665,468 probably benign Het
Sec14l4 T A 11: 4,043,948 I296N probably damaging Het
Serpinb12 G T 1: 106,956,612 V363F probably damaging Het
Serpinb9c A G 13: 33,150,033 I342T probably damaging Het
Shmt2 A G 10: 127,520,076 V133A probably damaging Het
Slc30a6 A G 17: 74,415,666 M243V probably benign Het
Slfn2 T A 11: 83,069,661 N155K probably damaging Het
Syne2 A T 12: 75,854,124 D19V possibly damaging Het
Tcl1b3 A T 12: 105,194,477 I116L probably benign Het
Tcp11 A G 17: 28,067,792 I411T probably damaging Het
Tctn1 C T 5: 122,241,796 A560T probably benign Het
Tenm3 C A 8: 48,229,181 Q2471H probably damaging Het
Tnr A G 1: 159,886,075 D691G probably benign Het
Ube3b C T 5: 114,390,390 P150S probably damaging Het
Ugt2b5 T C 5: 87,139,659 I216M possibly damaging Het
Unc5d T A 8: 28,666,849 R789S probably damaging Het
Ush2a G A 1: 188,415,678 G934D probably damaging Het
Usp6nl A T 2: 6,394,541 R70S probably damaging Het
Vmn1r181 T C 7: 23,984,884 I258T possibly damaging Het
Vmn2r15 C A 5: 109,297,436 D41Y probably damaging Het
Vmn2r17 T A 5: 109,452,825 I663N probably damaging Het
Vnn3 C A 10: 23,865,882 Q362K possibly damaging Het
Wdr72 A G 9: 74,152,448 D380G possibly damaging Het
Wfdc10 G A 2: 164,657,260 E97K possibly damaging Het
Xdh A T 17: 73,899,012 C1002* probably null Het
Zscan4e A C 7: 11,307,651 V126G probably damaging Het
Other mutations in Met
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00533:Met APN 6 17534937 unclassified probably benign
IGL01066:Met APN 6 17535105 critical splice donor site probably null
IGL01344:Met APN 6 17547032 missense probably benign 0.44
IGL01413:Met APN 6 17558896 splice site probably benign
IGL01608:Met APN 6 17558730 missense probably damaging 1.00
IGL01613:Met APN 6 17540577 missense probably damaging 1.00
IGL01820:Met APN 6 17534231 missense possibly damaging 0.89
IGL01843:Met APN 6 17491701 missense probably damaging 1.00
IGL02014:Met APN 6 17527257 splice site probably benign
IGL02027:Met APN 6 17563727 splice site probably benign
IGL02243:Met APN 6 17549094 missense probably damaging 1.00
IGL02373:Met APN 6 17491529 missense probably damaging 1.00
IGL02616:Met APN 6 17553347 missense probably damaging 1.00
IGL02702:Met APN 6 17534143 missense possibly damaging 0.92
IGL02704:Met APN 6 17491257 missense possibly damaging 0.62
IGL02714:Met APN 6 17491852 nonsense probably null
IGL02936:Met APN 6 17553397 missense probably damaging 1.00
IGL02943:Met APN 6 17535929 missense possibly damaging 0.84
IGL03057:Met APN 6 17558766 missense probably damaging 1.00
IGL03124:Met APN 6 17492078 missense probably benign 0.27
IGL03171:Met APN 6 17562273 splice site probably benign
IGL03266:Met APN 6 17540538 missense possibly damaging 0.61
IGL03285:Met APN 6 17553337 missense probably damaging 0.98
R0453:Met UTSW 6 17534198 missense possibly damaging 0.88
R0543:Met UTSW 6 17491970 missense probably damaging 1.00
R0601:Met UTSW 6 17555632 splice site probably null
R0652:Met UTSW 6 17491710 missense probably benign 0.00
R0941:Met UTSW 6 17491394 missense probably damaging 1.00
R1142:Met UTSW 6 17527183 nonsense probably null
R1553:Met UTSW 6 17491461 missense probably benign 0.01
R1569:Met UTSW 6 17531504 nonsense probably null
R1744:Met UTSW 6 17540646 missense possibly damaging 0.47
R2224:Met UTSW 6 17563722 splice site probably null
R2308:Met UTSW 6 17491742 missense probably benign 0.00
R2369:Met UTSW 6 17531528 missense probably benign 0.04
R2393:Met UTSW 6 17534198 missense probably damaging 0.99
R2419:Met UTSW 6 17535830 splice site probably benign
R2483:Met UTSW 6 17549086 missense probably damaging 1.00
R2511:Met UTSW 6 17491967 missense probably damaging 1.00
R3622:Met UTSW 6 17549086 missense probably damaging 1.00
R3623:Met UTSW 6 17549086 missense probably damaging 1.00
R3624:Met UTSW 6 17549086 missense probably damaging 1.00
R4050:Met UTSW 6 17533984 missense probably benign
R4051:Met UTSW 6 17548729 missense possibly damaging 0.86
R4159:Met UTSW 6 17562272 splice site probably null
R4208:Met UTSW 6 17548729 missense possibly damaging 0.86
R4622:Met UTSW 6 17513384 missense probably benign 0.19
R4672:Met UTSW 6 17571804 missense probably benign 0.33
R4737:Met UTSW 6 17491541 missense probably damaging 1.00
R4738:Met UTSW 6 17491541 missense probably damaging 1.00
R4834:Met UTSW 6 17491413 missense probably damaging 0.97
R4846:Met UTSW 6 17491929 missense probably damaging 0.99
R4855:Met UTSW 6 17558797 missense probably damaging 1.00
R4878:Met UTSW 6 17549059 missense probably damaging 1.00
R4902:Met UTSW 6 17546996 missense probably damaging 1.00
R5208:Met UTSW 6 17526423 nonsense probably null
R5355:Met UTSW 6 17491362 missense probably damaging 1.00
R5415:Met UTSW 6 17527085 missense probably benign 0.01
R5556:Met UTSW 6 17534176 missense probably benign 0.04
R5590:Met UTSW 6 17548782 missense probably benign 0.00
R5683:Met UTSW 6 17571744 missense probably damaging 1.00
R5872:Met UTSW 6 17562198 missense probably damaging 1.00
R5891:Met UTSW 6 17491539 missense probably benign 0.02
R5895:Met UTSW 6 17531582 missense probably benign 0.02
R6063:Met UTSW 6 17491968 missense probably damaging 1.00
R6262:Met UTSW 6 17553404 missense probably benign 0.00
R6362:Met UTSW 6 17558733 missense probably damaging 1.00
R6747:Met UTSW 6 17571467 missense probably damaging 1.00
R6966:Met UTSW 6 17531532 missense possibly damaging 0.65
R6989:Met UTSW 6 17535928 missense possibly damaging 0.67
R6989:Met UTSW 6 17535929 missense probably damaging 1.00
R7017:Met UTSW 6 17491287 nonsense probably null
R7037:Met UTSW 6 17547128 intron probably benign
R7141:Met UTSW 6 17527155 missense probably benign 0.01
R7242:Met UTSW 6 17491317 missense probably damaging 1.00
R7282:Met UTSW 6 17547012 nonsense probably null
R7624:Met UTSW 6 17558835 missense probably damaging 1.00
R7770:Met UTSW 6 17491407 missense possibly damaging 0.79
R7797:Met UTSW 6 17533953 missense probably damaging 1.00
R8082:Met UTSW 6 17492313 missense probably damaging 0.98
R8109:Met UTSW 6 17562237 missense probably damaging 1.00
R8162:Met UTSW 6 17547062 missense probably damaging 0.98
R8315:Met UTSW 6 17533957 missense probably damaging 0.99
R8325:Met UTSW 6 17571672 missense probably damaging 1.00
R8348:Met UTSW 6 17571800 missense probably benign 0.00
R8354:Met UTSW 6 17491769 missense probably damaging 1.00
R8448:Met UTSW 6 17571800 missense probably benign 0.00
R8454:Met UTSW 6 17491769 missense probably damaging 1.00
R8479:Met UTSW 6 17491747 splice site probably null
R8737:Met UTSW 6 17540511 missense probably benign 0.00
R8903:Met UTSW 6 17549138 missense probably benign 0.19
R8964:Met UTSW 6 17527145 missense probably damaging 1.00
R8998:Met UTSW 6 17491535 missense probably benign 0.43
R9088:Met UTSW 6 17548716 nonsense probably null
R9369:Met UTSW 6 17492229 missense probably benign
R9394:Met UTSW 6 17513396 missense probably damaging 1.00
R9530:Met UTSW 6 17558832 missense probably damaging 1.00
R9564:Met UTSW 6 17531426 missense probably benign
R9759:Met UTSW 6 17555562 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCATTATGCCTCTCACAG -3'
(R):5'- TCATAGTGGTGCAGTTACCG -3'

Sequencing Primer
(F):5'- GTGATGCTAAAATGCTGGCACCC -3'
(R):5'- TGGTGCAGTTACCGCAAAAGC -3'
Posted On 2021-01-18