Incidental Mutation 'R8465:Kcnd2'
ID 656761
Institutional Source Beutler Lab
Gene Symbol Kcnd2
Ensembl Gene ENSMUSG00000060882
Gene Name potassium voltage-gated channel, Shal-related family, member 2
Synonyms Kv4.2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock # R8465 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 21215503-21729805 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 21216696 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 133 (C133Y)
Ref Sequence ENSEMBL: ENSMUSP00000080257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081542]
AlphaFold Q9Z0V2
Predicted Effect probably damaging
Transcript: ENSMUST00000081542
AA Change: C133Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080257
Gene: ENSMUSG00000060882
AA Change: C133Y

DomainStartEndE-ValueType
Pfam:Shal-type 3 31 4.5e-16 PFAM
BTB 41 140 3.42e-14 SMART
Pfam:Ion_trans 184 417 1.4e-44 PFAM
Pfam:Ion_trans_2 330 411 5.5e-15 PFAM
low complexity region 418 437 N/A INTRINSIC
Pfam:DUF3399 445 546 5.5e-44 PFAM
low complexity region 594 608 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shal-related subfamily, members of which form voltage-activated A-type potassium ion channels and are prominent in the repolarization phase of the action potential. This member mediates a rapidly inactivating, A-type outward potassium current which is not under the control of the N terminus as it is in Shaker channels. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene reduces A-type currents in spinal cord dorsal horn neurons and increases their excitability, resulting in enhanced sensitivity to tactile and thermal stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,316,464 L23M possibly damaging Het
Acot6 A T 12: 84,106,441 probably null Het
Adamtsl3 A T 7: 82,598,122 N1429Y probably benign Het
Adk T C 14: 21,103,824 S32P possibly damaging Het
Akap13 A T 7: 75,727,038 M2005L probably benign Het
Atp10a A T 7: 58,828,310 D1367V probably benign Het
Bckdhb A G 9: 83,988,862 I142V probably benign Het
Brap C T 5: 121,679,295 Q322* probably null Het
Carmil3 A T 14: 55,496,848 N401I probably damaging Het
Cdan1 A T 2: 120,728,440 S426T possibly damaging Het
Cdc27 C A 11: 104,517,491 S531I probably benign Het
Cela3a A T 4: 137,403,874 Y184* probably null Het
Cep63 T C 9: 102,613,377 K178R probably benign Het
Cfb G A 17: 34,857,314 Q152* probably null Het
Cnpy2 G A 10: 128,326,175 V106I probably benign Het
Cntn1 GCTGTCTTC GC 15: 92,339,523 probably null Het
Ctc1 G A 11: 69,026,219 G67D probably damaging Het
Cwc27 G T 13: 104,804,264 P196T probably benign Het
Cwc27 C A 13: 104,804,268 L194F possibly damaging Het
Cyp2d12 T G 15: 82,555,177 S11A possibly damaging Het
Ddx55 T A 5: 124,559,121 probably null Het
Dedd2 G T 7: 25,218,906 R75S probably damaging Het
Fat2 G A 11: 55,256,704 S3904F possibly damaging Het
Fibp G A 19: 5,463,187 V177I probably damaging Het
Fsip2 A T 2: 82,979,940 E2201V probably benign Het
Gbp11 C T 5: 105,325,062 D499N probably benign Het
Gfm1 A G 3: 67,431,699 E45G probably damaging Het
Gm884 T A 11: 103,616,121 probably benign Het
H2-D1 A G 17: 35,263,511 Y69C probably damaging Het
Hcar1 A G 5: 123,879,046 F194S probably damaging Het
Heatr4 A T 12: 83,977,933 probably null Het
Kcnq1 A T 7: 143,425,974 Q619L probably benign Het
Kctd12 T A 14: 102,981,465 R326W probably damaging Het
Kel A G 6: 41,689,538 probably null Het
Lipk A T 19: 34,046,797 I332F probably benign Het
Masp2 A G 4: 148,612,059 D371G possibly damaging Het
Met A G 6: 17,571,810 E1376G probably benign Het
Mup5 A T 4: 61,833,778 I78K probably benign Het
Mynn A T 3: 30,616,641 D526V probably damaging Het
Naip6 G T 13: 100,296,915 T1138N possibly damaging Het
Neurod1 G T 2: 79,454,352 P229Q probably damaging Het
Npepps T G 11: 97,248,259 R162S probably damaging Het
Ntrk3 T A 7: 78,462,883 Q175L probably damaging Het
Obsl1 T C 1: 75,503,388 T310A probably damaging Het
Olfr1062 A T 2: 86,423,631 M15K probably benign Het
Olfr1079 A G 2: 86,538,387 I176T probably damaging Het
Olfr1288 A T 2: 111,479,080 T99S probably benign Het
Olfr25 A T 9: 38,330,114 I176F possibly damaging Het
Pigf G A 17: 86,997,536 T193I possibly damaging Het
Pkp4 T C 2: 59,342,181 V904A possibly damaging Het
Plekha6 C T 1: 133,270,040 T141M probably damaging Het
Rapgef6 G A 11: 54,691,482 D1407N probably benign Het
Rhobtb3 T C 13: 75,939,622 D82G probably damaging Het
Rims1 T C 1: 22,428,480 N767S possibly damaging Het
Ripor2 T A 13: 24,665,468 probably benign Het
Sec14l4 T A 11: 4,043,948 I296N probably damaging Het
Serpinb12 G T 1: 106,956,612 V363F probably damaging Het
Serpinb9c A G 13: 33,150,033 I342T probably damaging Het
Shmt2 A G 10: 127,520,076 V133A probably damaging Het
Slc30a6 A G 17: 74,415,666 M243V probably benign Het
Slfn2 T A 11: 83,069,661 N155K probably damaging Het
Syne2 A T 12: 75,854,124 D19V possibly damaging Het
Tcl1b3 A T 12: 105,194,477 I116L probably benign Het
Tcp11 A G 17: 28,067,792 I411T probably damaging Het
Tctn1 C T 5: 122,241,796 A560T probably benign Het
Tenm3 C A 8: 48,229,181 Q2471H probably damaging Het
Tnr A G 1: 159,886,075 D691G probably benign Het
Ube3b C T 5: 114,390,390 P150S probably damaging Het
Ugt2b5 T C 5: 87,139,659 I216M possibly damaging Het
Unc5d T A 8: 28,666,849 R789S probably damaging Het
Ush2a G A 1: 188,415,678 G934D probably damaging Het
Usp6nl A T 2: 6,394,541 R70S probably damaging Het
Vmn1r181 T C 7: 23,984,884 I258T possibly damaging Het
Vmn2r15 C A 5: 109,297,436 D41Y probably damaging Het
Vmn2r17 T A 5: 109,452,825 I663N probably damaging Het
Vnn3 C A 10: 23,865,882 Q362K possibly damaging Het
Wdr72 A G 9: 74,152,448 D380G possibly damaging Het
Wfdc10 G A 2: 164,657,260 E97K possibly damaging Het
Xdh A T 17: 73,899,012 C1002* probably null Het
Zscan4e A C 7: 11,307,651 V126G probably damaging Het
Other mutations in Kcnd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Kcnd2 APN 6 21714154 missense possibly damaging 0.90
IGL01124:Kcnd2 APN 6 21217217 missense probably damaging 1.00
IGL01317:Kcnd2 APN 6 21727340 makesense probably null
IGL01534:Kcnd2 APN 6 21726145 missense probably benign
IGL02623:Kcnd2 APN 6 21726195 missense probably benign 0.05
IGL02682:Kcnd2 APN 6 21216925 nonsense probably null
IGL02874:Kcnd2 APN 6 21216923 missense probably damaging 1.00
IGL02982:Kcnd2 APN 6 21217149 missense probably damaging 1.00
IGL02983:Kcnd2 APN 6 21216555 missense probably damaging 1.00
IGL03119:Kcnd2 APN 6 21216509 nonsense probably null
IGL03154:Kcnd2 APN 6 21216708 missense probably damaging 1.00
IGL03174:Kcnd2 APN 6 21216516 missense possibly damaging 0.93
IGL03296:Kcnd2 APN 6 21714209 missense probably damaging 1.00
R0062:Kcnd2 UTSW 6 21727226 missense possibly damaging 0.80
R0062:Kcnd2 UTSW 6 21727226 missense possibly damaging 0.80
R0325:Kcnd2 UTSW 6 21216683 missense probably damaging 0.99
R0771:Kcnd2 UTSW 6 21216442 missense probably damaging 1.00
R0836:Kcnd2 UTSW 6 21726239 splice site probably benign
R0836:Kcnd2 UTSW 6 21727329 missense probably damaging 1.00
R0884:Kcnd2 UTSW 6 21216541 missense probably benign
R1434:Kcnd2 UTSW 6 21216357 missense probably damaging 1.00
R2116:Kcnd2 UTSW 6 21216432 missense probably damaging 1.00
R3863:Kcnd2 UTSW 6 21217263 nonsense probably null
R3939:Kcnd2 UTSW 6 21217096 missense probably damaging 1.00
R4427:Kcnd2 UTSW 6 21216897 missense probably damaging 0.99
R4561:Kcnd2 UTSW 6 21216396 missense probably benign
R4707:Kcnd2 UTSW 6 21723212 missense probably benign
R5523:Kcnd2 UTSW 6 21723212 missense probably benign
R5545:Kcnd2 UTSW 6 21217019 missense probably damaging 1.00
R5926:Kcnd2 UTSW 6 21217085 missense probably damaging 0.99
R6900:Kcnd2 UTSW 6 21216588 missense probably damaging 1.00
R7010:Kcnd2 UTSW 6 21216708 missense probably damaging 1.00
R7028:Kcnd2 UTSW 6 21216178 start gained probably benign
R7183:Kcnd2 UTSW 6 21216437 missense probably damaging 1.00
R7387:Kcnd2 UTSW 6 21216778 missense probably benign 0.28
R7463:Kcnd2 UTSW 6 21216498 missense probably damaging 1.00
R8007:Kcnd2 UTSW 6 21217074 missense probably damaging 0.99
R8305:Kcnd2 UTSW 6 21726198 nonsense probably null
R9329:Kcnd2 UTSW 6 21725982 missense probably damaging 1.00
R9532:Kcnd2 UTSW 6 21727181 missense probably benign 0.16
R9766:Kcnd2 UTSW 6 21216368 missense probably benign 0.20
X0021:Kcnd2 UTSW 6 21217323 missense probably damaging 0.99
Z1177:Kcnd2 UTSW 6 21216416 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACATGGCAAGACACCCTG -3'
(R):5'- TAGTAGAACACCAGGGCCATG -3'

Sequencing Primer
(F):5'- TGAGAGAGACTTTTTCTACCACCCAG -3'
(R):5'- ACCAGGGCCATGGTGCTG -3'
Posted On 2021-01-18