Incidental Mutation 'R8465:Kcnd2'
ID 656761
Institutional Source Beutler Lab
Gene Symbol Kcnd2
Ensembl Gene ENSMUSG00000060882
Gene Name potassium voltage-gated channel, Shal-related family, member 2
Synonyms Kv4.2
MMRRC Submission 067909-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.130) question?
Stock # R8465 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 21215502-21729804 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 21216695 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 133 (C133Y)
Ref Sequence ENSEMBL: ENSMUSP00000080257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081542]
AlphaFold Q9Z0V2
Predicted Effect probably damaging
Transcript: ENSMUST00000081542
AA Change: C133Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080257
Gene: ENSMUSG00000060882
AA Change: C133Y

DomainStartEndE-ValueType
Pfam:Shal-type 3 31 4.5e-16 PFAM
BTB 41 140 3.42e-14 SMART
Pfam:Ion_trans 184 417 1.4e-44 PFAM
Pfam:Ion_trans_2 330 411 5.5e-15 PFAM
low complexity region 418 437 N/A INTRINSIC
Pfam:DUF3399 445 546 5.5e-44 PFAM
low complexity region 594 608 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shal-related subfamily, members of which form voltage-activated A-type potassium ion channels and are prominent in the repolarization phase of the action potential. This member mediates a rapidly inactivating, A-type outward potassium current which is not under the control of the N terminus as it is in Shaker channels. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene reduces A-type currents in spinal cord dorsal horn neurons and increases their excitability, resulting in enhanced sensitivity to tactile and thermal stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot6 A T 12: 84,153,215 (GRCm39) probably null Het
Adamtsl3 A T 7: 82,247,330 (GRCm39) N1429Y probably benign Het
Adk T C 14: 21,153,892 (GRCm39) S32P possibly damaging Het
Akap13 A T 7: 75,376,786 (GRCm39) M2005L probably benign Het
Atp10a A T 7: 58,478,058 (GRCm39) D1367V probably benign Het
Bckdhb A G 9: 83,870,915 (GRCm39) I142V probably benign Het
Brap C T 5: 121,817,358 (GRCm39) Q322* probably null Het
Carmil3 A T 14: 55,734,305 (GRCm39) N401I probably damaging Het
Cdan1 A T 2: 120,558,921 (GRCm39) S426T possibly damaging Het
Cdc27 C A 11: 104,408,317 (GRCm39) S531I probably benign Het
Cela3a A T 4: 137,131,185 (GRCm39) Y184* probably null Het
Cep63 T C 9: 102,490,576 (GRCm39) K178R probably benign Het
Cfb G A 17: 35,076,290 (GRCm39) Q152* probably null Het
Cnpy2 G A 10: 128,162,044 (GRCm39) V106I probably benign Het
Cntn1 GCTGTCTTC GC 15: 92,237,404 (GRCm39) probably null Het
Ctc1 G A 11: 68,917,045 (GRCm39) G67D probably damaging Het
Cwc27 G T 13: 104,940,772 (GRCm39) P196T probably benign Het
Cwc27 C A 13: 104,940,776 (GRCm39) L194F possibly damaging Het
Cyp2d12 T G 15: 82,439,378 (GRCm39) S11A possibly damaging Het
Ddx55 T A 5: 124,697,184 (GRCm39) probably null Het
Dedd2 G T 7: 24,918,331 (GRCm39) R75S probably damaging Het
Fat2 G A 11: 55,147,530 (GRCm39) S3904F possibly damaging Het
Fibp G A 19: 5,513,215 (GRCm39) V177I probably damaging Het
Fsip2 A T 2: 82,810,284 (GRCm39) E2201V probably benign Het
Gbp11 C T 5: 105,472,928 (GRCm39) D499N probably benign Het
Gfm1 A G 3: 67,339,032 (GRCm39) E45G probably damaging Het
H2-D1 A G 17: 35,482,487 (GRCm39) Y69C probably damaging Het
Hcar1 A G 5: 124,017,109 (GRCm39) F194S probably damaging Het
Heatr4 A T 12: 84,024,707 (GRCm39) probably null Het
Kcnq1 A T 7: 142,979,711 (GRCm39) Q619L probably benign Het
Kctd12 T A 14: 103,218,901 (GRCm39) R326W probably damaging Het
Kel A G 6: 41,666,472 (GRCm39) probably null Het
Lipk A T 19: 34,024,197 (GRCm39) I332F probably benign Het
Lrrc37 T A 11: 103,506,947 (GRCm39) probably benign Het
Masp2 A G 4: 148,696,516 (GRCm39) D371G possibly damaging Het
Met A G 6: 17,571,809 (GRCm39) E1376G probably benign Het
Mup5 A T 4: 61,752,015 (GRCm39) I78K probably benign Het
Mynn A T 3: 30,670,790 (GRCm39) D526V probably damaging Het
Naip6 G T 13: 100,433,423 (GRCm39) T1138N possibly damaging Het
Neurod1 G T 2: 79,284,696 (GRCm39) P229Q probably damaging Het
Npepps T G 11: 97,139,085 (GRCm39) R162S probably damaging Het
Ntrk3 T A 7: 78,112,631 (GRCm39) Q175L probably damaging Het
Obsl1 T C 1: 75,480,032 (GRCm39) T310A probably damaging Het
Or4g7 A T 2: 111,309,425 (GRCm39) T99S probably benign Het
Or8c9 A T 9: 38,241,410 (GRCm39) I176F possibly damaging Het
Or8j3c A T 2: 86,253,975 (GRCm39) M15K probably benign Het
Or8k32 A G 2: 86,368,731 (GRCm39) I176T probably damaging Het
Pigf G A 17: 87,304,964 (GRCm39) T193I possibly damaging Het
Pkp4 T C 2: 59,172,525 (GRCm39) V904A possibly damaging Het
Plekha6 C T 1: 133,197,778 (GRCm39) T141M probably damaging Het
Rapgef6 G A 11: 54,582,308 (GRCm39) D1407N probably benign Het
Rhobtb3 T C 13: 76,087,741 (GRCm39) D82G probably damaging Het
Rims1 T C 1: 22,498,731 (GRCm39) N767S possibly damaging Het
Ripor2 T A 13: 24,849,451 (GRCm39) probably benign Het
Sec14l4 T A 11: 3,993,948 (GRCm39) I296N probably damaging Het
Serpinb12 G T 1: 106,884,342 (GRCm39) V363F probably damaging Het
Serpinb9c A G 13: 33,334,016 (GRCm39) I342T probably damaging Het
Shmt2 A G 10: 127,355,945 (GRCm39) V133A probably damaging Het
Slc30a6 A G 17: 74,722,661 (GRCm39) M243V probably benign Het
Slfn2 T A 11: 82,960,487 (GRCm39) N155K probably damaging Het
Spata31h1 A T 10: 82,152,298 (GRCm39) L23M possibly damaging Het
Syne2 A T 12: 75,900,898 (GRCm39) D19V possibly damaging Het
Tcl1b3 A T 12: 105,160,736 (GRCm39) I116L probably benign Het
Tcp11 A G 17: 28,286,766 (GRCm39) I411T probably damaging Het
Tctn1 C T 5: 122,379,859 (GRCm39) A560T probably benign Het
Tenm3 C A 8: 48,682,216 (GRCm39) Q2471H probably damaging Het
Tnr A G 1: 159,713,645 (GRCm39) D691G probably benign Het
Ube3b C T 5: 114,528,451 (GRCm39) P150S probably damaging Het
Ugt2b5 T C 5: 87,287,518 (GRCm39) I216M possibly damaging Het
Unc5d T A 8: 29,156,877 (GRCm39) R789S probably damaging Het
Ush2a G A 1: 188,147,875 (GRCm39) G934D probably damaging Het
Usp6nl A T 2: 6,399,352 (GRCm39) R70S probably damaging Het
Vmn1r181 T C 7: 23,684,309 (GRCm39) I258T possibly damaging Het
Vmn2r15 C A 5: 109,445,302 (GRCm39) D41Y probably damaging Het
Vmn2r17 T A 5: 109,600,691 (GRCm39) I663N probably damaging Het
Vnn3 C A 10: 23,741,780 (GRCm39) Q362K possibly damaging Het
Wdr72 A G 9: 74,059,730 (GRCm39) D380G possibly damaging Het
Wfdc10 G A 2: 164,499,180 (GRCm39) E97K possibly damaging Het
Xdh A T 17: 74,206,007 (GRCm39) C1002* probably null Het
Zscan4e A C 7: 11,041,578 (GRCm39) V126G probably damaging Het
Other mutations in Kcnd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Kcnd2 APN 6 21,714,153 (GRCm39) missense possibly damaging 0.90
IGL01124:Kcnd2 APN 6 21,217,216 (GRCm39) missense probably damaging 1.00
IGL01317:Kcnd2 APN 6 21,727,339 (GRCm39) makesense probably null
IGL01534:Kcnd2 APN 6 21,726,144 (GRCm39) missense probably benign
IGL02623:Kcnd2 APN 6 21,726,194 (GRCm39) missense probably benign 0.05
IGL02682:Kcnd2 APN 6 21,216,924 (GRCm39) nonsense probably null
IGL02874:Kcnd2 APN 6 21,216,922 (GRCm39) missense probably damaging 1.00
IGL02982:Kcnd2 APN 6 21,217,148 (GRCm39) missense probably damaging 1.00
IGL02983:Kcnd2 APN 6 21,216,554 (GRCm39) missense probably damaging 1.00
IGL03119:Kcnd2 APN 6 21,216,508 (GRCm39) nonsense probably null
IGL03154:Kcnd2 APN 6 21,216,707 (GRCm39) missense probably damaging 1.00
IGL03174:Kcnd2 APN 6 21,216,515 (GRCm39) missense possibly damaging 0.93
IGL03296:Kcnd2 APN 6 21,714,208 (GRCm39) missense probably damaging 1.00
R0062:Kcnd2 UTSW 6 21,727,225 (GRCm39) missense possibly damaging 0.80
R0062:Kcnd2 UTSW 6 21,727,225 (GRCm39) missense possibly damaging 0.80
R0325:Kcnd2 UTSW 6 21,216,682 (GRCm39) missense probably damaging 0.99
R0771:Kcnd2 UTSW 6 21,216,441 (GRCm39) missense probably damaging 1.00
R0836:Kcnd2 UTSW 6 21,727,328 (GRCm39) missense probably damaging 1.00
R0836:Kcnd2 UTSW 6 21,726,238 (GRCm39) splice site probably benign
R0884:Kcnd2 UTSW 6 21,216,540 (GRCm39) missense probably benign
R1434:Kcnd2 UTSW 6 21,216,356 (GRCm39) missense probably damaging 1.00
R2116:Kcnd2 UTSW 6 21,216,431 (GRCm39) missense probably damaging 1.00
R3863:Kcnd2 UTSW 6 21,217,262 (GRCm39) nonsense probably null
R3939:Kcnd2 UTSW 6 21,217,095 (GRCm39) missense probably damaging 1.00
R4427:Kcnd2 UTSW 6 21,216,896 (GRCm39) missense probably damaging 0.99
R4561:Kcnd2 UTSW 6 21,216,395 (GRCm39) missense probably benign
R4707:Kcnd2 UTSW 6 21,723,211 (GRCm39) missense probably benign
R5523:Kcnd2 UTSW 6 21,723,211 (GRCm39) missense probably benign
R5545:Kcnd2 UTSW 6 21,217,018 (GRCm39) missense probably damaging 1.00
R5926:Kcnd2 UTSW 6 21,217,084 (GRCm39) missense probably damaging 0.99
R6900:Kcnd2 UTSW 6 21,216,587 (GRCm39) missense probably damaging 1.00
R7010:Kcnd2 UTSW 6 21,216,707 (GRCm39) missense probably damaging 1.00
R7028:Kcnd2 UTSW 6 21,216,177 (GRCm39) start gained probably benign
R7183:Kcnd2 UTSW 6 21,216,436 (GRCm39) missense probably damaging 1.00
R7387:Kcnd2 UTSW 6 21,216,777 (GRCm39) missense probably benign 0.28
R7463:Kcnd2 UTSW 6 21,216,497 (GRCm39) missense probably damaging 1.00
R8007:Kcnd2 UTSW 6 21,217,073 (GRCm39) missense probably damaging 0.99
R8305:Kcnd2 UTSW 6 21,726,197 (GRCm39) nonsense probably null
R9329:Kcnd2 UTSW 6 21,725,981 (GRCm39) missense probably damaging 1.00
R9532:Kcnd2 UTSW 6 21,727,180 (GRCm39) missense probably benign 0.16
R9766:Kcnd2 UTSW 6 21,216,367 (GRCm39) missense probably benign 0.20
X0021:Kcnd2 UTSW 6 21,217,322 (GRCm39) missense probably damaging 0.99
Z1177:Kcnd2 UTSW 6 21,216,415 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACATGGCAAGACACCCTG -3'
(R):5'- TAGTAGAACACCAGGGCCATG -3'

Sequencing Primer
(F):5'- TGAGAGAGACTTTTTCTACCACCCAG -3'
(R):5'- ACCAGGGCCATGGTGCTG -3'
Posted On 2021-01-18