Incidental Mutation 'R8465:Kel'
ID656762
Institutional Source Beutler Lab
Gene Symbol Kel
Ensembl Gene ENSMUSG00000029866
Gene NameKell blood group
SynonymsCD238
Accession Numbers

Genbank: NM_032540; MGI: 1346053

Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R8465 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location41686330-41704339 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 41689538 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000031899] [ENSMUST00000031900] [ENSMUST00000194597]
Predicted Effect probably null
Transcript: ENSMUST00000031899
SMART Domains Protein: ENSMUSP00000031899
Gene: ENSMUSG00000029866

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
Pfam:Peptidase_M13_N 81 463 1.5e-68 PFAM
Pfam:Peptidase_M13 521 712 2.1e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000031900
SMART Domains Protein: ENSMUSP00000031900
Gene: ENSMUSG00000029867

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:DUF4717 37 107 7.8e-39 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000192118
Predicted Effect probably benign
Transcript: ENSMUST00000194597
SMART Domains Protein: ENSMUSP00000142058
Gene: ENSMUSG00000029866

DomainStartEndE-ValueType
Pfam:Peptidase_M13 16 68 3.6e-10 PFAM
Meta Mutation Damage Score 0.9495 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II transmembrane glycoprotein that is the highly polymorphic Kell blood group antigen. The Kell glycoprotein links via a single disulfide bond to the XK membrane protein that carries the Kx antigen. The encoded protein contains sequence and structural similarity to members of the neprilysin (M13) family of zinc endopeptidases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased heart rate, altered hematological parameters and ECG waveform features, decreased erythrocyte Mg2+ and K+ ion content, mild motor deficits, and giant axon changes with varying degrees of paranodal demyelination in the spinal cord and sciatic nerve. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,316,464 L23M possibly damaging Het
Acot6 A T 12: 84,106,441 probably null Het
Adamtsl3 A T 7: 82,598,122 N1429Y probably benign Het
Adk T C 14: 21,103,824 S32P possibly damaging Het
Akap13 A T 7: 75,727,038 M2005L probably benign Het
Atp10a A T 7: 58,828,310 D1367V probably benign Het
Bckdhb A G 9: 83,988,862 I142V probably benign Het
Brap C T 5: 121,679,295 Q322* probably null Het
Carmil3 A T 14: 55,496,848 N401I probably damaging Het
Cdan1 A T 2: 120,728,440 S426T possibly damaging Het
Cdc27 C A 11: 104,517,491 S531I probably benign Het
Cela3a A T 4: 137,403,874 Y184* probably null Het
Cep63 T C 9: 102,613,377 K178R probably benign Het
Cfb G A 17: 34,857,314 Q152* probably null Het
Cnpy2 G A 10: 128,326,175 V106I probably benign Het
Cntn1 GCTGTCTTC GC 15: 92,339,523 probably null Het
Ctc1 G A 11: 69,026,219 G67D probably damaging Het
Cwc27 G T 13: 104,804,264 P196T probably benign Het
Cwc27 C A 13: 104,804,268 L194F possibly damaging Het
Cyp2d12 T G 15: 82,555,177 S11A possibly damaging Het
Ddx55 T A 5: 124,559,121 probably null Het
Dedd2 G T 7: 25,218,906 R75S probably damaging Het
Fat2 G A 11: 55,256,704 S3904F possibly damaging Het
Fibp G A 19: 5,463,187 V177I probably damaging Het
Fsip2 A T 2: 82,979,940 E2201V probably benign Het
Gbp11 C T 5: 105,325,062 D499N probably benign Het
Gfm1 A G 3: 67,431,699 E45G probably damaging Het
Gm884 T A 11: 103,616,121 probably benign Het
H2-D1 A G 17: 35,263,511 Y69C probably damaging Het
Hcar1 A G 5: 123,879,046 F194S probably damaging Het
Heatr4 A T 12: 83,977,933 probably null Het
Kcnd2 G A 6: 21,216,696 C133Y probably damaging Het
Kcnq1 A T 7: 143,425,974 Q619L probably benign Het
Kctd12 T A 14: 102,981,465 R326W probably damaging Het
Lipk A T 19: 34,046,797 I332F probably benign Het
Masp2 A G 4: 148,612,059 D371G possibly damaging Het
Met A G 6: 17,571,810 E1376G probably benign Het
Mup5 A T 4: 61,833,778 I78K probably benign Het
Mynn A T 3: 30,616,641 D526V probably damaging Het
Naip6 G T 13: 100,296,915 T1138N possibly damaging Het
Neurod1 G T 2: 79,454,352 P229Q probably damaging Het
Npepps T G 11: 97,248,259 R162S probably damaging Het
Ntrk3 T A 7: 78,462,883 Q175L probably damaging Het
Obsl1 T C 1: 75,503,388 T310A probably damaging Het
Olfr1062 A T 2: 86,423,631 M15K probably benign Het
Olfr1079 A G 2: 86,538,387 I176T probably damaging Het
Olfr1288 A T 2: 111,479,080 T99S probably benign Het
Olfr25 A T 9: 38,330,114 I176F possibly damaging Het
Pigf G A 17: 86,997,536 T193I possibly damaging Het
Pkp4 T C 2: 59,342,181 V904A possibly damaging Het
Plekha6 C T 1: 133,270,040 T141M probably damaging Het
Rapgef6 G A 11: 54,691,482 D1407N probably benign Het
Rhobtb3 T C 13: 75,939,622 D82G probably damaging Het
Rims1 T C 1: 22,428,480 N767S possibly damaging Het
Ripor2 T A 13: 24,665,468 probably benign Het
Sec14l4 T A 11: 4,043,948 I296N probably damaging Het
Serpinb12 G T 1: 106,956,612 V363F probably damaging Het
Serpinb9c A G 13: 33,150,033 I342T probably damaging Het
Shmt2 A G 10: 127,520,076 V133A probably damaging Het
Slc30a6 A G 17: 74,415,666 M243V probably benign Het
Slfn2 T A 11: 83,069,661 N155K probably damaging Het
Syne2 A T 12: 75,854,124 D19V possibly damaging Het
Tcl1b3 A T 12: 105,194,477 I116L probably benign Het
Tcp11 A G 17: 28,067,792 I411T probably damaging Het
Tctn1 C T 5: 122,241,796 A560T probably benign Het
Tenm3 C A 8: 48,229,181 Q2471H probably damaging Het
Tnr A G 1: 159,886,075 D691G probably benign Het
Ube3b C T 5: 114,390,390 P150S probably damaging Het
Ugt2b5 T C 5: 87,139,659 I216M possibly damaging Het
Unc5d T A 8: 28,666,849 R789S probably damaging Het
Ush2a G A 1: 188,415,678 G934D probably damaging Het
Usp6nl A T 2: 6,394,541 R70S probably damaging Het
Vmn1r181 T C 7: 23,984,884 I258T possibly damaging Het
Vmn2r15 C A 5: 109,297,436 D41Y probably damaging Het
Vmn2r17 T A 5: 109,452,825 I663N probably damaging Het
Vnn3 C A 10: 23,865,882 Q362K possibly damaging Het
Wdr72 A G 9: 74,152,448 D380G possibly damaging Het
Wfdc10 G A 2: 164,657,260 E97K possibly damaging Het
Xdh A T 17: 73,899,012 C1002* probably null Het
Zscan4e A C 7: 11,307,651 V126G probably damaging Het
Other mutations in Kel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Kel APN 6 41688575 missense probably damaging 1.00
IGL00792:Kel APN 6 41702012 missense probably damaging 1.00
IGL00972:Kel APN 6 41688066 missense possibly damaging 0.62
IGL01121:Kel APN 6 41702409 missense probably benign 0.00
IGL01286:Kel APN 6 41688117 splice site probably null
IGL01461:Kel APN 6 41701911 critical splice donor site probably null
IGL01836:Kel APN 6 41697438 missense possibly damaging 0.50
IGL02037:Kel APN 6 41697474 missense probably benign 0.01
IGL02103:Kel APN 6 41702389 missense probably benign 0.18
IGL02604:Kel APN 6 41687582 missense probably damaging 0.98
IGL03102:Kel APN 6 41702983 missense probably benign 0.00
IGL03274:Kel APN 6 41687995 splice site probably null
IGL03355:Kel APN 6 41698887 critical splice donor site probably null
A4554:Kel UTSW 6 41697419 missense possibly damaging 0.95
R0121:Kel UTSW 6 41702064 unclassified probably benign
R0153:Kel UTSW 6 41701943 missense probably benign 0.08
R0535:Kel UTSW 6 41690838 missense probably null 0.21
R0658:Kel UTSW 6 41703031 missense probably damaging 1.00
R1005:Kel UTSW 6 41688617 missense probably damaging 1.00
R1199:Kel UTSW 6 41688591 missense possibly damaging 0.95
R1272:Kel UTSW 6 41703470 missense probably benign 0.00
R1531:Kel UTSW 6 41688626 missense probably damaging 0.99
R1880:Kel UTSW 6 41687545 missense possibly damaging 0.95
R2102:Kel UTSW 6 41686484 missense possibly damaging 0.86
R2118:Kel UTSW 6 41689300 missense probably benign
R2571:Kel UTSW 6 41688067 missense possibly damaging 0.62
R4209:Kel UTSW 6 41698425 nonsense probably null
R4210:Kel UTSW 6 41698425 nonsense probably null
R4260:Kel UTSW 6 41686423 utr 3 prime probably benign
R4382:Kel UTSW 6 41698400 missense probably benign 0.13
R5023:Kel UTSW 6 41688111 missense probably damaging 1.00
R5033:Kel UTSW 6 41699055 missense probably damaging 1.00
R5239:Kel UTSW 6 41688114 nonsense probably null
R5431:Kel UTSW 6 41698420 missense probably benign 0.23
R5742:Kel UTSW 6 41699027 missense probably damaging 1.00
R5745:Kel UTSW 6 41699027 missense probably damaging 1.00
R5746:Kel UTSW 6 41699027 missense probably damaging 1.00
R5978:Kel UTSW 6 41688045 missense probably benign 0.00
R6023:Kel UTSW 6 41697475 missense probably benign
R6109:Kel UTSW 6 41688862 missense probably benign 0.06
R6125:Kel UTSW 6 41690786 missense probably damaging 1.00
R6319:Kel UTSW 6 41702447 missense probably benign 0.05
R6368:Kel UTSW 6 41688851 nonsense probably null
R6864:Kel UTSW 6 41703760 critical splice donor site probably null
R6956:Kel UTSW 6 41687973 missense probably damaging 1.00
R7644:Kel UTSW 6 41690808 missense probably benign 0.03
R7938:Kel UTSW 6 41698376 missense probably benign 0.06
R8028:Kel UTSW 6 41699024 missense probably benign 0.21
R8082:Kel UTSW 6 41703490 missense possibly damaging 0.94
X0028:Kel UTSW 6 41698351 missense probably damaging 0.99
Z1176:Kel UTSW 6 41687572 missense probably damaging 1.00
Z1177:Kel UTSW 6 41689559 missense probably benign
Predicted Primers PCR Primer
(F):5'- GACACAGAAATTTGTAAGTTGCCAG -3'
(R):5'- AGAAACCTTCTTGTGAGCCC -3'

Sequencing Primer
(F):5'- GTTGCCAGAATTCCCTCATAAATC -3'
(R):5'- CCAGTAGGGTCAAGGTCTCTTTACAG -3'
Posted On2021-01-18