Mutagenetix > Incidental Mutations

Incidental Mutation 'R8465:Kel'

656762

Institutional Source

Beutler Lab

Gene Symbol

Kel

Ensembl Gene

ENSMUSG00000029866

Gene Name

Kell blood group

Synonyms

CD238

Accession Numbers

Genbank: NM_032540; MGI: 1346053

Is this an essential gene?

Probably non essential (E-score: 0.076) question?

Stock #

R8465 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

41686330-41704339 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 41689538 bp

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031899] [ENSMUST00000031900] [ENSMUST00000194597]

Predicted Effect

probably null
Transcript: ENSMUST00000031899

SMART Domains

Protein: ENSMUSP00000031899
Gene: ENSMUSG00000029866

Domain	Start	End	E-Value	Type
transmembrane domain	28	50	N/A	INTRINSIC
Pfam:Peptidase_M13_N	81	463	1.5e-68	PFAM
Pfam:Peptidase_M13	521	712	2.1e-58	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000031900

SMART Domains

Protein: ENSMUSP00000031900
Gene: ENSMUSG00000029867

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
Pfam:DUF4717	37	107	7.8e-39	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000192118

Predicted Effect

probably benign
Transcript: ENSMUST00000194597

SMART Domains

Protein: ENSMUSP00000142058
Gene: ENSMUSG00000029866

Domain	Start	End	E-Value	Type
Pfam:Peptidase_M13	16	68	3.6e-10	PFAM

Meta Mutation Damage Score

0.9495

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (80/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II transmembrane glycoprotein that is the highly polymorphic Kell blood group antigen. The Kell glycoprotein links via a single disulfide bond to the XK membrane protein that carries the Kx antigen. The encoded protein contains sequence and structural similarity to members of the neprilysin (M13) family of zinc endopeptidases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased heart rate, altered hematological parameters and ECG waveform features, decreased erythrocyte Mg2+ and K+ ion content, mild motor deficits, and giant axon changes with varying degrees of paranodal demyelination in the spinal cord and sciatic nerve. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	A	T	10: 82,316,464	L23M	possibly damaging	Het
Acot6	A	T	12: 84,106,441		probably null	Het
Adamtsl3	A	T	7: 82,598,122	N1429Y	probably benign	Het
Adk	T	C	14: 21,103,824	S32P	possibly damaging	Het
Akap13	A	T	7: 75,727,038	M2005L	probably benign	Het
Atp10a	A	T	7: 58,828,310	D1367V	probably benign	Het
Bckdhb	A	G	9: 83,988,862	I142V	probably benign	Het
Brap	C	T	5: 121,679,295	Q322*	probably null	Het
Carmil3	A	T	14: 55,496,848	N401I	probably damaging	Het
Cdan1	A	T	2: 120,728,440	S426T	possibly damaging	Het
Cdc27	C	A	11: 104,517,491	S531I	probably benign	Het
Cela3a	A	T	4: 137,403,874	Y184*	probably null	Het
Cep63	T	C	9: 102,613,377	K178R	probably benign	Het
Cfb	G	A	17: 34,857,314	Q152*	probably null	Het
Cnpy2	G	A	10: 128,326,175	V106I	probably benign	Het
Cntn1	GCTGTCTTC	GC	15: 92,339,523		probably null	Het
Ctc1	G	A	11: 69,026,219	G67D	probably damaging	Het
Cwc27	G	T	13: 104,804,264	P196T	probably benign	Het
Cwc27	C	A	13: 104,804,268	L194F	possibly damaging	Het
Cyp2d12	T	G	15: 82,555,177	S11A	possibly damaging	Het
Ddx55	T	A	5: 124,559,121		probably null	Het
Dedd2	G	T	7: 25,218,906	R75S	probably damaging	Het
Fat2	G	A	11: 55,256,704	S3904F	possibly damaging	Het
Fibp	G	A	19: 5,463,187	V177I	probably damaging	Het
Fsip2	A	T	2: 82,979,940	E2201V	probably benign	Het
Gbp11	C	T	5: 105,325,062	D499N	probably benign	Het
Gfm1	A	G	3: 67,431,699	E45G	probably damaging	Het
Gm884	T	A	11: 103,616,121		probably benign	Het
H2-D1	A	G	17: 35,263,511	Y69C	probably damaging	Het
Hcar1	A	G	5: 123,879,046	F194S	probably damaging	Het
Heatr4	A	T	12: 83,977,933		probably null	Het
Kcnd2	G	A	6: 21,216,696	C133Y	probably damaging	Het
Kcnq1	A	T	7: 143,425,974	Q619L	probably benign	Het
Kctd12	T	A	14: 102,981,465	R326W	probably damaging	Het
Lipk	A	T	19: 34,046,797	I332F	probably benign	Het
Masp2	A	G	4: 148,612,059	D371G	possibly damaging	Het
Met	A	G	6: 17,571,810	E1376G	probably benign	Het
Mup5	A	T	4: 61,833,778	I78K	probably benign	Het
Mynn	A	T	3: 30,616,641	D526V	probably damaging	Het
Naip6	G	T	13: 100,296,915	T1138N	possibly damaging	Het
Neurod1	G	T	2: 79,454,352	P229Q	probably damaging	Het
Npepps	T	G	11: 97,248,259	R162S	probably damaging	Het
Ntrk3	T	A	7: 78,462,883	Q175L	probably damaging	Het
Obsl1	T	C	1: 75,503,388	T310A	probably damaging	Het
Olfr1062	A	T	2: 86,423,631	M15K	probably benign	Het
Olfr1079	A	G	2: 86,538,387	I176T	probably damaging	Het
Olfr1288	A	T	2: 111,479,080	T99S	probably benign	Het
Olfr25	A	T	9: 38,330,114	I176F	possibly damaging	Het
Pigf	G	A	17: 86,997,536	T193I	possibly damaging	Het
Pkp4	T	C	2: 59,342,181	V904A	possibly damaging	Het
Plekha6	C	T	1: 133,270,040	T141M	probably damaging	Het
Rapgef6	G	A	11: 54,691,482	D1407N	probably benign	Het
Rhobtb3	T	C	13: 75,939,622	D82G	probably damaging	Het
Rims1	T	C	1: 22,428,480	N767S	possibly damaging	Het
Ripor2	T	A	13: 24,665,468		probably benign	Het
Sec14l4	T	A	11: 4,043,948	I296N	probably damaging	Het
Serpinb12	G	T	1: 106,956,612	V363F	probably damaging	Het
Serpinb9c	A	G	13: 33,150,033	I342T	probably damaging	Het
Shmt2	A	G	10: 127,520,076	V133A	probably damaging	Het
Slc30a6	A	G	17: 74,415,666	M243V	probably benign	Het
Slfn2	T	A	11: 83,069,661	N155K	probably damaging	Het
Syne2	A	T	12: 75,854,124	D19V	possibly damaging	Het
Tcl1b3	A	T	12: 105,194,477	I116L	probably benign	Het
Tcp11	A	G	17: 28,067,792	I411T	probably damaging	Het
Tctn1	C	T	5: 122,241,796	A560T	probably benign	Het
Tenm3	C	A	8: 48,229,181	Q2471H	probably damaging	Het
Tnr	A	G	1: 159,886,075	D691G	probably benign	Het
Ube3b	C	T	5: 114,390,390	P150S	probably damaging	Het
Ugt2b5	T	C	5: 87,139,659	I216M	possibly damaging	Het
Unc5d	T	A	8: 28,666,849	R789S	probably damaging	Het
Ush2a	G	A	1: 188,415,678	G934D	probably damaging	Het
Usp6nl	A	T	2: 6,394,541	R70S	probably damaging	Het
Vmn1r181	T	C	7: 23,984,884	I258T	possibly damaging	Het
Vmn2r15	C	A	5: 109,297,436	D41Y	probably damaging	Het
Vmn2r17	T	A	5: 109,452,825	I663N	probably damaging	Het
Vnn3	C	A	10: 23,865,882	Q362K	possibly damaging	Het
Wdr72	A	G	9: 74,152,448	D380G	possibly damaging	Het
Wfdc10	G	A	2: 164,657,260	E97K	possibly damaging	Het
Xdh	A	T	17: 73,899,012	C1002*	probably null	Het
Zscan4e	A	C	7: 11,307,651	V126G	probably damaging	Het

Other mutations in Kel

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00743:Kel	APN	6	41688575	missense	probably damaging	1.00
IGL00792:Kel	APN	6	41702012	missense	probably damaging	1.00
IGL00972:Kel	APN	6	41688066	missense	possibly damaging	0.62
IGL01121:Kel	APN	6	41702409	missense	probably benign	0.00
IGL01286:Kel	APN	6	41688117	splice site	probably null
IGL01461:Kel	APN	6	41701911	critical splice donor site	probably null
IGL01836:Kel	APN	6	41697438	missense	possibly damaging	0.50
IGL02037:Kel	APN	6	41697474	missense	probably benign	0.01
IGL02103:Kel	APN	6	41702389	missense	probably benign	0.18
IGL02604:Kel	APN	6	41687582	missense	probably damaging	0.98
IGL03102:Kel	APN	6	41702983	missense	probably benign	0.00
IGL03274:Kel	APN	6	41687995	splice site	probably null
IGL03355:Kel	APN	6	41698887	critical splice donor site	probably null
A4554:Kel	UTSW	6	41697419	missense	possibly damaging	0.95
R0121:Kel	UTSW	6	41702064	unclassified	probably benign
R0153:Kel	UTSW	6	41701943	missense	probably benign	0.08
R0535:Kel	UTSW	6	41690838	missense	probably null	0.21
R0658:Kel	UTSW	6	41703031	missense	probably damaging	1.00
R1005:Kel	UTSW	6	41688617	missense	probably damaging	1.00
R1199:Kel	UTSW	6	41688591	missense	possibly damaging	0.95
R1272:Kel	UTSW	6	41703470	missense	probably benign	0.00
R1531:Kel	UTSW	6	41688626	missense	probably damaging	0.99
R1880:Kel	UTSW	6	41687545	missense	possibly damaging	0.95
R2102:Kel	UTSW	6	41686484	missense	possibly damaging	0.86
R2118:Kel	UTSW	6	41689300	missense	probably benign
R2571:Kel	UTSW	6	41688067	missense	possibly damaging	0.62
R4209:Kel	UTSW	6	41698425	nonsense	probably null
R4210:Kel	UTSW	6	41698425	nonsense	probably null
R4260:Kel	UTSW	6	41686423	utr 3 prime	probably benign
R4382:Kel	UTSW	6	41698400	missense	probably benign	0.13
R5023:Kel	UTSW	6	41688111	missense	probably damaging	1.00
R5033:Kel	UTSW	6	41699055	missense	probably damaging	1.00
R5239:Kel	UTSW	6	41688114	nonsense	probably null
R5431:Kel	UTSW	6	41698420	missense	probably benign	0.23
R5742:Kel	UTSW	6	41699027	missense	probably damaging	1.00
R5745:Kel	UTSW	6	41699027	missense	probably damaging	1.00
R5746:Kel	UTSW	6	41699027	missense	probably damaging	1.00
R5978:Kel	UTSW	6	41688045	missense	probably benign	0.00
R6023:Kel	UTSW	6	41697475	missense	probably benign
R6109:Kel	UTSW	6	41688862	missense	probably benign	0.06
R6125:Kel	UTSW	6	41690786	missense	probably damaging	1.00
R6319:Kel	UTSW	6	41702447	missense	probably benign	0.05
R6368:Kel	UTSW	6	41688851	nonsense	probably null
R6864:Kel	UTSW	6	41703760	critical splice donor site	probably null
R6956:Kel	UTSW	6	41687973	missense	probably damaging	1.00
R7644:Kel	UTSW	6	41690808	missense	probably benign	0.03
R7938:Kel	UTSW	6	41698376	missense	probably benign	0.06
R8028:Kel	UTSW	6	41699024	missense	probably benign	0.21
R8082:Kel	UTSW	6	41703490	missense	possibly damaging	0.94
X0028:Kel	UTSW	6	41698351	missense	probably damaging	0.99
Z1176:Kel	UTSW	6	41687572	missense	probably damaging	1.00
Z1177:Kel	UTSW	6	41689559	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GACACAGAAATTTGTAAGTTGCCAG -3'
(R):5'- AGAAACCTTCTTGTGAGCCC -3'

Sequencing Primer
(F):5'- GTTGCCAGAATTCCCTCATAAATC -3'
(R):5'- CCAGTAGGGTCAAGGTCTCTTTACAG -3'

Posted On

2021-01-18