Incidental Mutation 'R8465:Akap13'
ID 656767
Institutional Source Beutler Lab
Gene Symbol Akap13
Ensembl Gene ENSMUSG00000066406
Gene Name A kinase anchor protein 13
Synonyms PROTO-LB, Ht31, 5830460E08Rik, 5730522G15Rik, 1700026G02Rik, PROTO-LBC, AKAP-Lbc
MMRRC Submission 067909-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8465 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 75105282-75404357 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 75376786 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 2005 (M2005L)
Ref Sequence ENSEMBL: ENSMUSP00000147237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166315] [ENSMUST00000207239] [ENSMUST00000207750]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000166315
AA Change: M1987L

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000129784
Gene: ENSMUSG00000066406
AA Change: M1987L

DomainStartEndE-ValueType
low complexity region 174 184 N/A INTRINSIC
low complexity region 773 789 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
low complexity region 1021 1032 N/A INTRINSIC
low complexity region 1433 1448 N/A INTRINSIC
low complexity region 1483 1505 N/A INTRINSIC
low complexity region 1583 1594 N/A INTRINSIC
low complexity region 1720 1750 N/A INTRINSIC
C1 1755 1801 1.95e-4 SMART
low complexity region 1858 1869 N/A INTRINSIC
RhoGEF 1961 2153 1.28e-61 SMART
PH 2195 2298 2.94e-11 SMART
coiled coil region 2308 2345 N/A INTRINSIC
low complexity region 2393 2412 N/A INTRINSIC
low complexity region 2444 2454 N/A INTRINSIC
coiled coil region 2533 2646 N/A INTRINSIC
low complexity region 2728 2734 N/A INTRINSIC
low complexity region 2740 2753 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207239
AA Change: M286L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000207750
AA Change: M2005L

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms containing c-terminal dbl oncogene homology (DH) and pleckstrin homology (PH) domains. The DH domain is associated with guanine nucleotide exchange activation for the Rho/Rac family of small GTP binding proteins, resulting in the conversion of the inactive GTPase to the active form capable of transducing signals. The PH domain has multiple functions. Therefore, these isoforms function as scaffolding proteins to coordinate a Rho signaling pathway, function as protein kinase A-anchoring proteins and, in addition, enhance ligand-dependent activity of estrogen receptors alpha and beta. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis, arrested heart development, and forebrain hypoplasia. Heterozygous mice exhibit small spleen, impaired lymphocyte response to osmotic stress, decreased response to glucocorticoid, osteoporosis and impared osteogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot6 A T 12: 84,153,215 (GRCm39) probably null Het
Adamtsl3 A T 7: 82,247,330 (GRCm39) N1429Y probably benign Het
Adk T C 14: 21,153,892 (GRCm39) S32P possibly damaging Het
Atp10a A T 7: 58,478,058 (GRCm39) D1367V probably benign Het
Bckdhb A G 9: 83,870,915 (GRCm39) I142V probably benign Het
Brap C T 5: 121,817,358 (GRCm39) Q322* probably null Het
Carmil3 A T 14: 55,734,305 (GRCm39) N401I probably damaging Het
Cdan1 A T 2: 120,558,921 (GRCm39) S426T possibly damaging Het
Cdc27 C A 11: 104,408,317 (GRCm39) S531I probably benign Het
Cela3a A T 4: 137,131,185 (GRCm39) Y184* probably null Het
Cep63 T C 9: 102,490,576 (GRCm39) K178R probably benign Het
Cfb G A 17: 35,076,290 (GRCm39) Q152* probably null Het
Cnpy2 G A 10: 128,162,044 (GRCm39) V106I probably benign Het
Cntn1 GCTGTCTTC GC 15: 92,237,404 (GRCm39) probably null Het
Ctc1 G A 11: 68,917,045 (GRCm39) G67D probably damaging Het
Cwc27 G T 13: 104,940,772 (GRCm39) P196T probably benign Het
Cwc27 C A 13: 104,940,776 (GRCm39) L194F possibly damaging Het
Cyp2d12 T G 15: 82,439,378 (GRCm39) S11A possibly damaging Het
Ddx55 T A 5: 124,697,184 (GRCm39) probably null Het
Dedd2 G T 7: 24,918,331 (GRCm39) R75S probably damaging Het
Fat2 G A 11: 55,147,530 (GRCm39) S3904F possibly damaging Het
Fibp G A 19: 5,513,215 (GRCm39) V177I probably damaging Het
Fsip2 A T 2: 82,810,284 (GRCm39) E2201V probably benign Het
Gbp11 C T 5: 105,472,928 (GRCm39) D499N probably benign Het
Gfm1 A G 3: 67,339,032 (GRCm39) E45G probably damaging Het
H2-D1 A G 17: 35,482,487 (GRCm39) Y69C probably damaging Het
Hcar1 A G 5: 124,017,109 (GRCm39) F194S probably damaging Het
Heatr4 A T 12: 84,024,707 (GRCm39) probably null Het
Kcnd2 G A 6: 21,216,695 (GRCm39) C133Y probably damaging Het
Kcnq1 A T 7: 142,979,711 (GRCm39) Q619L probably benign Het
Kctd12 T A 14: 103,218,901 (GRCm39) R326W probably damaging Het
Kel A G 6: 41,666,472 (GRCm39) probably null Het
Lipk A T 19: 34,024,197 (GRCm39) I332F probably benign Het
Lrrc37 T A 11: 103,506,947 (GRCm39) probably benign Het
Masp2 A G 4: 148,696,516 (GRCm39) D371G possibly damaging Het
Met A G 6: 17,571,809 (GRCm39) E1376G probably benign Het
Mup5 A T 4: 61,752,015 (GRCm39) I78K probably benign Het
Mynn A T 3: 30,670,790 (GRCm39) D526V probably damaging Het
Naip6 G T 13: 100,433,423 (GRCm39) T1138N possibly damaging Het
Neurod1 G T 2: 79,284,696 (GRCm39) P229Q probably damaging Het
Npepps T G 11: 97,139,085 (GRCm39) R162S probably damaging Het
Ntrk3 T A 7: 78,112,631 (GRCm39) Q175L probably damaging Het
Obsl1 T C 1: 75,480,032 (GRCm39) T310A probably damaging Het
Or4g7 A T 2: 111,309,425 (GRCm39) T99S probably benign Het
Or8c9 A T 9: 38,241,410 (GRCm39) I176F possibly damaging Het
Or8j3c A T 2: 86,253,975 (GRCm39) M15K probably benign Het
Or8k32 A G 2: 86,368,731 (GRCm39) I176T probably damaging Het
Pigf G A 17: 87,304,964 (GRCm39) T193I possibly damaging Het
Pkp4 T C 2: 59,172,525 (GRCm39) V904A possibly damaging Het
Plekha6 C T 1: 133,197,778 (GRCm39) T141M probably damaging Het
Rapgef6 G A 11: 54,582,308 (GRCm39) D1407N probably benign Het
Rhobtb3 T C 13: 76,087,741 (GRCm39) D82G probably damaging Het
Rims1 T C 1: 22,498,731 (GRCm39) N767S possibly damaging Het
Ripor2 T A 13: 24,849,451 (GRCm39) probably benign Het
Sec14l4 T A 11: 3,993,948 (GRCm39) I296N probably damaging Het
Serpinb12 G T 1: 106,884,342 (GRCm39) V363F probably damaging Het
Serpinb9c A G 13: 33,334,016 (GRCm39) I342T probably damaging Het
Shmt2 A G 10: 127,355,945 (GRCm39) V133A probably damaging Het
Slc30a6 A G 17: 74,722,661 (GRCm39) M243V probably benign Het
Slfn2 T A 11: 82,960,487 (GRCm39) N155K probably damaging Het
Spata31h1 A T 10: 82,152,298 (GRCm39) L23M possibly damaging Het
Syne2 A T 12: 75,900,898 (GRCm39) D19V possibly damaging Het
Tcl1b3 A T 12: 105,160,736 (GRCm39) I116L probably benign Het
Tcp11 A G 17: 28,286,766 (GRCm39) I411T probably damaging Het
Tctn1 C T 5: 122,379,859 (GRCm39) A560T probably benign Het
Tenm3 C A 8: 48,682,216 (GRCm39) Q2471H probably damaging Het
Tnr A G 1: 159,713,645 (GRCm39) D691G probably benign Het
Ube3b C T 5: 114,528,451 (GRCm39) P150S probably damaging Het
Ugt2b5 T C 5: 87,287,518 (GRCm39) I216M possibly damaging Het
Unc5d T A 8: 29,156,877 (GRCm39) R789S probably damaging Het
Ush2a G A 1: 188,147,875 (GRCm39) G934D probably damaging Het
Usp6nl A T 2: 6,399,352 (GRCm39) R70S probably damaging Het
Vmn1r181 T C 7: 23,684,309 (GRCm39) I258T possibly damaging Het
Vmn2r15 C A 5: 109,445,302 (GRCm39) D41Y probably damaging Het
Vmn2r17 T A 5: 109,600,691 (GRCm39) I663N probably damaging Het
Vnn3 C A 10: 23,741,780 (GRCm39) Q362K possibly damaging Het
Wdr72 A G 9: 74,059,730 (GRCm39) D380G possibly damaging Het
Wfdc10 G A 2: 164,499,180 (GRCm39) E97K possibly damaging Het
Xdh A T 17: 74,206,007 (GRCm39) C1002* probably null Het
Zscan4e A C 7: 11,041,578 (GRCm39) V126G probably damaging Het
Other mutations in Akap13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Akap13 APN 7 75,375,719 (GRCm39) missense probably damaging 0.99
IGL00332:Akap13 APN 7 75,378,667 (GRCm39) missense probably damaging 1.00
IGL00481:Akap13 APN 7 75,373,643 (GRCm39) missense probably damaging 1.00
IGL00590:Akap13 APN 7 75,260,417 (GRCm39) missense probably benign 0.01
IGL00655:Akap13 APN 7 75,354,146 (GRCm39) missense probably damaging 0.99
IGL00766:Akap13 APN 7 75,354,260 (GRCm39) missense probably damaging 0.96
IGL00818:Akap13 APN 7 75,259,475 (GRCm39) missense probably benign 0.00
IGL00826:Akap13 APN 7 75,327,195 (GRCm39) missense probably damaging 1.00
IGL01014:Akap13 APN 7 75,400,381 (GRCm39) utr 3 prime probably benign
IGL01090:Akap13 APN 7 75,316,279 (GRCm39) missense probably benign 0.44
IGL01155:Akap13 APN 7 75,219,684 (GRCm39) missense probably damaging 1.00
IGL01326:Akap13 APN 7 75,375,096 (GRCm39) missense probably benign 0.30
IGL01456:Akap13 APN 7 75,252,595 (GRCm39) missense probably damaging 0.98
IGL01460:Akap13 APN 7 75,397,594 (GRCm39) missense probably benign 0.29
IGL01568:Akap13 APN 7 75,258,270 (GRCm39) nonsense probably null 0.00
IGL01610:Akap13 APN 7 75,397,353 (GRCm39) missense probably damaging 1.00
IGL01610:Akap13 APN 7 75,369,928 (GRCm39) missense possibly damaging 0.71
IGL01615:Akap13 APN 7 75,347,141 (GRCm39) missense probably damaging 1.00
IGL01667:Akap13 APN 7 75,219,767 (GRCm39) missense probably damaging 1.00
IGL01705:Akap13 APN 7 75,396,515 (GRCm39) missense possibly damaging 0.86
IGL02070:Akap13 APN 7 75,316,293 (GRCm39) missense probably benign 0.27
IGL02269:Akap13 APN 7 75,252,659 (GRCm39) missense probably benign
IGL02421:Akap13 APN 7 75,367,554 (GRCm39) missense possibly damaging 0.66
IGL02870:Akap13 APN 7 75,258,936 (GRCm39) missense probably damaging 0.96
IGL02944:Akap13 APN 7 75,258,405 (GRCm39) missense probably benign
IGL03051:Akap13 APN 7 75,260,233 (GRCm39) nonsense probably null
IGL03160:Akap13 APN 7 75,380,165 (GRCm39) missense probably damaging 1.00
IGL03245:Akap13 APN 7 75,259,500 (GRCm39) missense probably damaging 0.99
R0254:Akap13 UTSW 7 75,386,352 (GRCm39) splice site probably benign
R0310:Akap13 UTSW 7 75,264,678 (GRCm39) missense probably damaging 0.99
R0373:Akap13 UTSW 7 75,380,248 (GRCm39) missense probably damaging 1.00
R0373:Akap13 UTSW 7 75,259,677 (GRCm39) missense probably benign 0.00
R0408:Akap13 UTSW 7 75,396,544 (GRCm39) missense probably damaging 1.00
R0631:Akap13 UTSW 7 75,264,744 (GRCm39) missense probably damaging 0.99
R0646:Akap13 UTSW 7 75,397,494 (GRCm39) missense probably damaging 1.00
R0781:Akap13 UTSW 7 75,261,125 (GRCm39) missense possibly damaging 0.56
R0845:Akap13 UTSW 7 75,375,128 (GRCm39) missense probably damaging 1.00
R1004:Akap13 UTSW 7 75,337,034 (GRCm39) missense probably damaging 0.99
R1024:Akap13 UTSW 7 75,327,157 (GRCm39) missense probably damaging 1.00
R1110:Akap13 UTSW 7 75,261,125 (GRCm39) missense possibly damaging 0.56
R1346:Akap13 UTSW 7 75,259,340 (GRCm39) missense possibly damaging 0.67
R1349:Akap13 UTSW 7 75,259,340 (GRCm39) missense possibly damaging 0.67
R1372:Akap13 UTSW 7 75,259,340 (GRCm39) missense possibly damaging 0.67
R1387:Akap13 UTSW 7 75,235,941 (GRCm39) missense probably damaging 0.97
R1442:Akap13 UTSW 7 75,385,526 (GRCm39) missense probably damaging 0.99
R1466:Akap13 UTSW 7 75,378,797 (GRCm39) missense possibly damaging 0.79
R1466:Akap13 UTSW 7 75,378,797 (GRCm39) missense possibly damaging 0.79
R1584:Akap13 UTSW 7 75,378,797 (GRCm39) missense possibly damaging 0.79
R1696:Akap13 UTSW 7 75,259,340 (GRCm39) missense possibly damaging 0.67
R1738:Akap13 UTSW 7 75,326,942 (GRCm39) missense probably damaging 1.00
R1773:Akap13 UTSW 7 75,333,199 (GRCm39) missense possibly damaging 0.80
R1785:Akap13 UTSW 7 75,261,182 (GRCm39) missense probably benign 0.16
R1786:Akap13 UTSW 7 75,261,182 (GRCm39) missense probably benign 0.16
R1791:Akap13 UTSW 7 75,260,783 (GRCm39) missense probably benign 0.00
R1819:Akap13 UTSW 7 75,258,453 (GRCm39) missense probably benign 0.04
R1879:Akap13 UTSW 7 75,260,475 (GRCm39) missense probably benign 0.01
R1989:Akap13 UTSW 7 75,354,264 (GRCm39) missense probably benign 0.01
R2016:Akap13 UTSW 7 75,354,279 (GRCm39) missense probably damaging 0.99
R2092:Akap13 UTSW 7 75,260,318 (GRCm39) missense probably benign 0.05
R2126:Akap13 UTSW 7 75,375,052 (GRCm39) missense possibly damaging 0.95
R2131:Akap13 UTSW 7 75,261,182 (GRCm39) missense probably benign 0.16
R2132:Akap13 UTSW 7 75,261,182 (GRCm39) missense probably benign 0.16
R2133:Akap13 UTSW 7 75,261,182 (GRCm39) missense probably benign 0.16
R2251:Akap13 UTSW 7 75,389,225 (GRCm39) missense possibly damaging 0.50
R3704:Akap13 UTSW 7 75,316,298 (GRCm39) missense probably damaging 1.00
R3713:Akap13 UTSW 7 75,235,929 (GRCm39) missense probably damaging 0.98
R3731:Akap13 UTSW 7 75,261,125 (GRCm39) missense probably benign 0.39
R3765:Akap13 UTSW 7 75,258,585 (GRCm39) missense probably benign 0.04
R3788:Akap13 UTSW 7 75,351,901 (GRCm39) critical splice donor site probably null
R3793:Akap13 UTSW 7 75,259,889 (GRCm39) missense probably benign 0.00
R3970:Akap13 UTSW 7 75,219,699 (GRCm39) nonsense probably null
R4205:Akap13 UTSW 7 75,260,667 (GRCm39) missense probably benign 0.05
R4257:Akap13 UTSW 7 75,261,033 (GRCm39) missense probably damaging 0.98
R4374:Akap13 UTSW 7 75,258,732 (GRCm39) missense probably damaging 0.96
R4448:Akap13 UTSW 7 75,392,508 (GRCm39) missense probably damaging 1.00
R4450:Akap13 UTSW 7 75,392,508 (GRCm39) missense probably damaging 1.00
R4457:Akap13 UTSW 7 75,389,213 (GRCm39) missense probably damaging 0.99
R4458:Akap13 UTSW 7 75,389,213 (GRCm39) missense probably damaging 0.99
R4466:Akap13 UTSW 7 75,252,521 (GRCm39) splice site probably null
R4632:Akap13 UTSW 7 75,316,301 (GRCm39) missense possibly damaging 0.91
R4667:Akap13 UTSW 7 75,378,842 (GRCm39) missense probably damaging 1.00
R4669:Akap13 UTSW 7 75,378,842 (GRCm39) missense probably damaging 1.00
R4671:Akap13 UTSW 7 75,229,312 (GRCm39) nonsense probably null
R4821:Akap13 UTSW 7 75,327,255 (GRCm39) intron probably benign
R4868:Akap13 UTSW 7 75,393,252 (GRCm39) missense probably damaging 1.00
R4894:Akap13 UTSW 7 75,375,068 (GRCm39) missense possibly damaging 0.76
R4943:Akap13 UTSW 7 75,398,988 (GRCm39) missense probably benign 0.22
R4962:Akap13 UTSW 7 75,399,178 (GRCm39) missense probably damaging 0.98
R4988:Akap13 UTSW 7 75,380,276 (GRCm39) missense probably damaging 1.00
R5119:Akap13 UTSW 7 75,337,000 (GRCm39) missense probably damaging 0.98
R5141:Akap13 UTSW 7 75,259,362 (GRCm39) missense probably benign 0.18
R5419:Akap13 UTSW 7 75,259,991 (GRCm39) missense probably benign 0.01
R5427:Akap13 UTSW 7 75,378,617 (GRCm39) missense possibly damaging 0.89
R5429:Akap13 UTSW 7 75,252,652 (GRCm39) missense possibly damaging 0.70
R5432:Akap13 UTSW 7 75,252,578 (GRCm39) missense probably damaging 1.00
R5458:Akap13 UTSW 7 75,236,049 (GRCm39) missense probably damaging 1.00
R5636:Akap13 UTSW 7 75,354,120 (GRCm39) missense probably damaging 0.96
R5643:Akap13 UTSW 7 75,351,902 (GRCm39) critical splice donor site probably null
R5898:Akap13 UTSW 7 75,378,894 (GRCm39) missense probably damaging 1.00
R5932:Akap13 UTSW 7 75,259,932 (GRCm39) missense probably damaging 1.00
R6135:Akap13 UTSW 7 75,259,656 (GRCm39) missense possibly damaging 0.94
R6137:Akap13 UTSW 7 75,327,164 (GRCm39) missense probably damaging 1.00
R6182:Akap13 UTSW 7 75,236,028 (GRCm39) missense probably benign 0.45
R6310:Akap13 UTSW 7 75,398,941 (GRCm39) missense probably damaging 0.99
R6346:Akap13 UTSW 7 75,335,002 (GRCm39) missense probably damaging 1.00
R6466:Akap13 UTSW 7 75,376,792 (GRCm39) missense probably benign 0.01
R6605:Akap13 UTSW 7 75,229,516 (GRCm39) missense probably damaging 0.98
R6617:Akap13 UTSW 7 75,380,111 (GRCm39) missense possibly damaging 0.95
R6621:Akap13 UTSW 7 75,219,729 (GRCm39) missense probably damaging 1.00
R6703:Akap13 UTSW 7 75,252,646 (GRCm39) missense probably damaging 1.00
R6750:Akap13 UTSW 7 75,389,206 (GRCm39) missense probably benign 0.03
R7069:Akap13 UTSW 7 75,260,010 (GRCm39) missense probably benign 0.29
R7116:Akap13 UTSW 7 75,369,943 (GRCm39) missense probably benign 0.00
R7158:Akap13 UTSW 7 75,229,342 (GRCm39) missense probably damaging 0.97
R7159:Akap13 UTSW 7 75,380,327 (GRCm39) missense possibly damaging 0.72
R7467:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R7468:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R7471:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R7472:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R7477:Akap13 UTSW 7 75,398,995 (GRCm39) missense probably benign
R7636:Akap13 UTSW 7 75,259,621 (GRCm39) missense probably benign 0.04
R7650:Akap13 UTSW 7 75,293,202 (GRCm39) missense probably benign 0.20
R7671:Akap13 UTSW 7 75,219,648 (GRCm39) missense probably damaging 1.00
R7681:Akap13 UTSW 7 75,378,544 (GRCm39) missense possibly damaging 0.91
R7752:Akap13 UTSW 7 75,327,006 (GRCm39) missense possibly damaging 0.74
R7784:Akap13 UTSW 7 75,260,076 (GRCm39) missense probably benign 0.00
R7816:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R7817:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R7834:Akap13 UTSW 7 75,392,390 (GRCm39) missense possibly damaging 0.85
R7880:Akap13 UTSW 7 75,235,964 (GRCm39) missense probably damaging 0.97
R7942:Akap13 UTSW 7 75,261,218 (GRCm39) missense possibly damaging 0.50
R8006:Akap13 UTSW 7 75,229,444 (GRCm39) missense probably damaging 1.00
R8009:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R8011:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R8012:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R8013:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R8016:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R8089:Akap13 UTSW 7 75,260,340 (GRCm39) missense possibly damaging 0.94
R8138:Akap13 UTSW 7 75,351,979 (GRCm39) splice site probably null
R8174:Akap13 UTSW 7 75,378,617 (GRCm39) missense possibly damaging 0.89
R8298:Akap13 UTSW 7 75,397,552 (GRCm39) missense probably damaging 1.00
R8444:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R8445:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R8512:Akap13 UTSW 7 75,260,834 (GRCm39) missense probably damaging 0.99
R8523:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R8793:Akap13 UTSW 7 75,375,076 (GRCm39) missense probably benign 0.35
R8907:Akap13 UTSW 7 75,260,456 (GRCm39) missense probably damaging 0.99
R8907:Akap13 UTSW 7 75,260,444 (GRCm39) missense probably benign 0.08
R8928:Akap13 UTSW 7 75,259,606 (GRCm39) missense probably benign 0.00
R8929:Akap13 UTSW 7 75,258,752 (GRCm39) missense probably benign 0.00
R8937:Akap13 UTSW 7 75,184,601 (GRCm39) critical splice donor site probably null
R8967:Akap13 UTSW 7 75,378,882 (GRCm39) missense possibly damaging 0.80
R8986:Akap13 UTSW 7 75,259,074 (GRCm39) missense probably benign
R9152:Akap13 UTSW 7 75,261,033 (GRCm39) missense probably damaging 0.98
R9153:Akap13 UTSW 7 75,259,229 (GRCm39) missense probably benign 0.00
R9160:Akap13 UTSW 7 75,385,526 (GRCm39) missense possibly damaging 0.88
R9192:Akap13 UTSW 7 75,354,249 (GRCm39) missense probably benign 0.06
R9319:Akap13 UTSW 7 75,258,836 (GRCm39) missense probably benign 0.01
R9513:Akap13 UTSW 7 75,354,275 (GRCm39) missense probably benign 0.01
R9515:Akap13 UTSW 7 75,354,275 (GRCm39) missense probably benign 0.01
R9516:Akap13 UTSW 7 75,354,275 (GRCm39) missense probably benign 0.01
R9523:Akap13 UTSW 7 75,293,193 (GRCm39) missense
R9564:Akap13 UTSW 7 75,259,161 (GRCm39) missense probably benign
R9621:Akap13 UTSW 7 75,386,090 (GRCm39) missense probably benign 0.09
R9686:Akap13 UTSW 7 75,236,084 (GRCm39) missense probably damaging 1.00
Z1176:Akap13 UTSW 7 75,380,300 (GRCm39) missense probably damaging 0.99
Z1177:Akap13 UTSW 7 75,264,753 (GRCm39) missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GAAGACGGCTGTTTGCTCAG -3'
(R):5'- TCCAGAGTTACAAAGCTTCTCTC -3'

Sequencing Primer
(F):5'- TCAGCCTCAAGATTTCCATCAGG -3'
(R):5'- GCTGCTCACCTGACTGACAAG -3'
Posted On 2021-01-18