Incidental Mutation 'R8465:Wdr72'
ID 656774
Institutional Source Beutler Lab
Gene Symbol Wdr72
Ensembl Gene ENSMUSG00000044976
Gene Name WD repeat domain 72
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock # R8465 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 74110356-74283308 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 74152448 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 380 (D380G)
Ref Sequence ENSEMBL: ENSMUSP00000149349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055879] [ENSMUST00000215440]
AlphaFold D3YYM4
Predicted Effect possibly damaging
Transcript: ENSMUST00000055879
AA Change: D392G

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000057320
Gene: ENSMUSG00000044976
AA Change: D392G

DomainStartEndE-ValueType
WD40 4 45 1.24e0 SMART
WD40 51 93 1.54e0 SMART
WD40 143 188 8.22e1 SMART
Blast:WD40 319 363 4e-19 BLAST
WD40 398 443 8.88e0 SMART
WD40 461 506 5.97e-1 SMART
WD40 509 554 9.9e0 SMART
WD40 557 596 2.12e-3 SMART
low complexity region 694 711 N/A INTRINSIC
low complexity region 780 798 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000215440
AA Change: D380G

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with eight WD-40 repeats. Mutations in this gene have been associated with amelogenesis imperfecta hypomaturation type 2A3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a null allele display hypomineralized enamel, ameloblast abnormalities and decreased post-weaning body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,316,464 L23M possibly damaging Het
Acot6 A T 12: 84,106,441 probably null Het
Adamtsl3 A T 7: 82,598,122 N1429Y probably benign Het
Adk T C 14: 21,103,824 S32P possibly damaging Het
Akap13 A T 7: 75,727,038 M2005L probably benign Het
Atp10a A T 7: 58,828,310 D1367V probably benign Het
Bckdhb A G 9: 83,988,862 I142V probably benign Het
Brap C T 5: 121,679,295 Q322* probably null Het
Carmil3 A T 14: 55,496,848 N401I probably damaging Het
Cdan1 A T 2: 120,728,440 S426T possibly damaging Het
Cdc27 C A 11: 104,517,491 S531I probably benign Het
Cela3a A T 4: 137,403,874 Y184* probably null Het
Cep63 T C 9: 102,613,377 K178R probably benign Het
Cfb G A 17: 34,857,314 Q152* probably null Het
Cnpy2 G A 10: 128,326,175 V106I probably benign Het
Cntn1 GCTGTCTTC GC 15: 92,339,523 probably null Het
Ctc1 G A 11: 69,026,219 G67D probably damaging Het
Cwc27 G T 13: 104,804,264 P196T probably benign Het
Cwc27 C A 13: 104,804,268 L194F possibly damaging Het
Cyp2d12 T G 15: 82,555,177 S11A possibly damaging Het
Ddx55 T A 5: 124,559,121 probably null Het
Dedd2 G T 7: 25,218,906 R75S probably damaging Het
Fat2 G A 11: 55,256,704 S3904F possibly damaging Het
Fibp G A 19: 5,463,187 V177I probably damaging Het
Fsip2 A T 2: 82,979,940 E2201V probably benign Het
Gbp11 C T 5: 105,325,062 D499N probably benign Het
Gfm1 A G 3: 67,431,699 E45G probably damaging Het
Gm884 T A 11: 103,616,121 probably benign Het
H2-D1 A G 17: 35,263,511 Y69C probably damaging Het
Hcar1 A G 5: 123,879,046 F194S probably damaging Het
Heatr4 A T 12: 83,977,933 probably null Het
Kcnd2 G A 6: 21,216,696 C133Y probably damaging Het
Kcnq1 A T 7: 143,425,974 Q619L probably benign Het
Kctd12 T A 14: 102,981,465 R326W probably damaging Het
Kel A G 6: 41,689,538 probably null Het
Lipk A T 19: 34,046,797 I332F probably benign Het
Masp2 A G 4: 148,612,059 D371G possibly damaging Het
Met A G 6: 17,571,810 E1376G probably benign Het
Mup5 A T 4: 61,833,778 I78K probably benign Het
Mynn A T 3: 30,616,641 D526V probably damaging Het
Naip6 G T 13: 100,296,915 T1138N possibly damaging Het
Neurod1 G T 2: 79,454,352 P229Q probably damaging Het
Npepps T G 11: 97,248,259 R162S probably damaging Het
Ntrk3 T A 7: 78,462,883 Q175L probably damaging Het
Obsl1 T C 1: 75,503,388 T310A probably damaging Het
Olfr1062 A T 2: 86,423,631 M15K probably benign Het
Olfr1079 A G 2: 86,538,387 I176T probably damaging Het
Olfr1288 A T 2: 111,479,080 T99S probably benign Het
Olfr25 A T 9: 38,330,114 I176F possibly damaging Het
Pigf G A 17: 86,997,536 T193I possibly damaging Het
Pkp4 T C 2: 59,342,181 V904A possibly damaging Het
Plekha6 C T 1: 133,270,040 T141M probably damaging Het
Rapgef6 G A 11: 54,691,482 D1407N probably benign Het
Rhobtb3 T C 13: 75,939,622 D82G probably damaging Het
Rims1 T C 1: 22,428,480 N767S possibly damaging Het
Ripor2 T A 13: 24,665,468 probably benign Het
Sec14l4 T A 11: 4,043,948 I296N probably damaging Het
Serpinb12 G T 1: 106,956,612 V363F probably damaging Het
Serpinb9c A G 13: 33,150,033 I342T probably damaging Het
Shmt2 A G 10: 127,520,076 V133A probably damaging Het
Slc30a6 A G 17: 74,415,666 M243V probably benign Het
Slfn2 T A 11: 83,069,661 N155K probably damaging Het
Syne2 A T 12: 75,854,124 D19V possibly damaging Het
Tcl1b3 A T 12: 105,194,477 I116L probably benign Het
Tcp11 A G 17: 28,067,792 I411T probably damaging Het
Tctn1 C T 5: 122,241,796 A560T probably benign Het
Tenm3 C A 8: 48,229,181 Q2471H probably damaging Het
Tnr A G 1: 159,886,075 D691G probably benign Het
Ube3b C T 5: 114,390,390 P150S probably damaging Het
Ugt2b5 T C 5: 87,139,659 I216M possibly damaging Het
Unc5d T A 8: 28,666,849 R789S probably damaging Het
Ush2a G A 1: 188,415,678 G934D probably damaging Het
Usp6nl A T 2: 6,394,541 R70S probably damaging Het
Vmn1r181 T C 7: 23,984,884 I258T possibly damaging Het
Vmn2r15 C A 5: 109,297,436 D41Y probably damaging Het
Vmn2r17 T A 5: 109,452,825 I663N probably damaging Het
Vnn3 C A 10: 23,865,882 Q362K possibly damaging Het
Wfdc10 G A 2: 164,657,260 E97K possibly damaging Het
Xdh A T 17: 73,899,012 C1002* probably null Het
Zscan4e A C 7: 11,307,651 V126G probably damaging Het
Other mutations in Wdr72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Wdr72 APN 9 74155129 missense probably damaging 1.00
IGL01385:Wdr72 APN 9 74179506 splice site probably benign
IGL01512:Wdr72 APN 9 74148759 missense probably benign 0.02
IGL01544:Wdr72 APN 9 74148725 missense probably damaging 1.00
IGL01938:Wdr72 APN 9 74148774 missense probably benign 0.25
IGL02090:Wdr72 APN 9 74154930 missense possibly damaging 0.87
IGL02121:Wdr72 APN 9 74281729 utr 3 prime probably benign
IGL02140:Wdr72 APN 9 74210223 missense probably benign 0.40
IGL02171:Wdr72 APN 9 74210534 missense possibly damaging 0.94
IGL02208:Wdr72 APN 9 74157299 missense probably damaging 1.00
IGL02936:Wdr72 APN 9 74152580 missense probably damaging 1.00
IGL02979:Wdr72 APN 9 74179556 missense probably damaging 1.00
IGL03263:Wdr72 APN 9 74157429 missense probably damaging 1.00
Arresting UTSW 9 74179501 splice site probably benign
R0332_Wdr72_931 UTSW 9 74157252 critical splice acceptor site probably null
R2036_Wdr72_658 UTSW 9 74151594 missense probably damaging 1.00
F5770:Wdr72 UTSW 9 74157270 missense probably damaging 0.96
R0107:Wdr72 UTSW 9 74210433 missense probably damaging 1.00
R0332:Wdr72 UTSW 9 74157252 critical splice acceptor site probably null
R0420:Wdr72 UTSW 9 74210757 missense possibly damaging 0.75
R0536:Wdr72 UTSW 9 74157408 missense probably damaging 1.00
R0565:Wdr72 UTSW 9 74217306 missense probably benign 0.34
R0755:Wdr72 UTSW 9 74145094 missense probably benign 0.05
R1183:Wdr72 UTSW 9 74179585 missense probably benign 0.00
R1636:Wdr72 UTSW 9 74179625 missense probably benign 0.00
R1668:Wdr72 UTSW 9 74210162 missense probably damaging 0.99
R1687:Wdr72 UTSW 9 74210199 missense probably benign 0.13
R1813:Wdr72 UTSW 9 74276016 missense possibly damaging 0.85
R1835:Wdr72 UTSW 9 74151617 missense probably damaging 1.00
R2036:Wdr72 UTSW 9 74151594 missense probably damaging 1.00
R2113:Wdr72 UTSW 9 74145172 missense probably benign 0.07
R2331:Wdr72 UTSW 9 74148326 missense probably damaging 1.00
R2369:Wdr72 UTSW 9 74210175 missense possibly damaging 0.77
R3973:Wdr72 UTSW 9 74218697 missense probably benign
R4021:Wdr72 UTSW 9 74151593 missense probably benign 0.18
R4596:Wdr72 UTSW 9 74151605 missense probably benign 0.00
R4665:Wdr72 UTSW 9 74210024 missense probably benign 0.10
R4694:Wdr72 UTSW 9 74179555 missense probably damaging 1.00
R4894:Wdr72 UTSW 9 74210561 missense probably benign 0.00
R5027:Wdr72 UTSW 9 74145976 missense probably damaging 1.00
R5269:Wdr72 UTSW 9 74157371 missense probably damaging 1.00
R5432:Wdr72 UTSW 9 74275946 missense probably damaging 1.00
R5470:Wdr72 UTSW 9 74139699 nonsense probably null
R5717:Wdr72 UTSW 9 74148205 missense probably damaging 1.00
R5793:Wdr72 UTSW 9 74210343 missense probably benign 0.02
R5963:Wdr72 UTSW 9 74145028 missense probably damaging 1.00
R6108:Wdr72 UTSW 9 74151668 missense probably damaging 0.97
R6111:Wdr72 UTSW 9 74210325 missense probably benign 0.00
R6113:Wdr72 UTSW 9 74152641 missense probably benign 0.02
R6245:Wdr72 UTSW 9 74148223 missense probably damaging 1.00
R6469:Wdr72 UTSW 9 74213361 missense probably benign 0.15
R6726:Wdr72 UTSW 9 74152540 missense possibly damaging 0.54
R6857:Wdr72 UTSW 9 74155041 missense probably damaging 1.00
R6916:Wdr72 UTSW 9 74155039 missense probably benign
R6921:Wdr72 UTSW 9 74210646 missense probably benign
R7092:Wdr72 UTSW 9 74210472 missense probably damaging 1.00
R7104:Wdr72 UTSW 9 74148315 missense probably damaging 1.00
R7560:Wdr72 UTSW 9 74210126 missense probably damaging 1.00
R7684:Wdr72 UTSW 9 74147010 missense probably damaging 1.00
R8025:Wdr72 UTSW 9 74143499 missense probably benign 0.00
R8035:Wdr72 UTSW 9 74179501 splice site probably benign
R8079:Wdr72 UTSW 9 74218772 missense probably damaging 0.99
R8142:Wdr72 UTSW 9 74139667 missense probably damaging 1.00
R8166:Wdr72 UTSW 9 74213328 missense probably benign
R8266:Wdr72 UTSW 9 74143492 missense probably damaging 1.00
R8968:Wdr72 UTSW 9 74152447 missense probably benign 0.31
R9074:Wdr72 UTSW 9 74218620 missense possibly damaging 0.86
R9336:Wdr72 UTSW 9 74210010 missense probably damaging 1.00
R9643:Wdr72 UTSW 9 74210759 missense probably damaging 1.00
V7583:Wdr72 UTSW 9 74157270 missense probably damaging 0.96
X0067:Wdr72 UTSW 9 74152502 missense probably damaging 1.00
Z1177:Wdr72 UTSW 9 74210536 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGAGAAGTAACTTGTACAGACACC -3'
(R):5'- TAGAAGTCCAGCTTTGGCAG -3'

Sequencing Primer
(F):5'- GTAACTTGTACAGACACCAATACCG -3'
(R):5'- AGGTGATGGTAGCTGTCA -3'
Posted On 2021-01-18