Incidental Mutation 'R8465:Rapgef6'
ID 656782
Institutional Source Beutler Lab
Gene Symbol Rapgef6
Ensembl Gene ENSMUSG00000037533
Gene Name Rap guanine nucleotide exchange factor (GEF) 6
Synonyms PDZ-GEF2, Pdzgef2, C030018K18Rik, RA-GEF-2
MMRRC Submission
Accession Numbers

Genbank: NM_175258; MGI: 2384761

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8465 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 54522847-54699285 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 54691482 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 1407 (D1407N)
Ref Sequence ENSEMBL: ENSMUSP00000099804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094536] [ENSMUST00000101206] [ENSMUST00000102743] [ENSMUST00000108894] [ENSMUST00000207429]
AlphaFold Q5NCJ1
Predicted Effect probably benign
Transcript: ENSMUST00000094536
SMART Domains Protein: ENSMUSP00000092114
Gene: ENSMUSG00000037533

DomainStartEndE-ValueType
cNMP 1 113 6.64e-7 SMART
RasGEFN 127 240 4.35e-33 SMART
PDZ 255 327 8.86e-16 SMART
low complexity region 409 420 N/A INTRINSIC
RA 464 550 1.47e-20 SMART
RasGEF 571 853 3.88e-84 SMART
low complexity region 944 957 N/A INTRINSIC
low complexity region 972 989 N/A INTRINSIC
low complexity region 1016 1061 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101206
AA Change: D1415N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000098766
Gene: ENSMUSG00000037533
AA Change: D1415N

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.45e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 525 4.35e-33 SMART
PDZ 540 612 8.86e-16 SMART
low complexity region 694 705 N/A INTRINSIC
RA 749 835 1.47e-20 SMART
RasGEF 856 1095 5.35e-87 SMART
low complexity region 1237 1250 N/A INTRINSIC
low complexity region 1270 1293 N/A INTRINSIC
low complexity region 1345 1364 N/A INTRINSIC
low complexity region 1368 1380 N/A INTRINSIC
low complexity region 1444 1452 N/A INTRINSIC
low complexity region 1555 1568 N/A INTRINSIC
low complexity region 1591 1604 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102743
AA Change: D1407N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099804
Gene: ENSMUSG00000037533
AA Change: D1407N

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.42e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 525 4.35e-33 SMART
PDZ 540 612 8.86e-16 SMART
low complexity region 694 705 N/A INTRINSIC
RA 749 835 1.47e-20 SMART
RasGEF 856 1138 3.88e-84 SMART
low complexity region 1229 1242 N/A INTRINSIC
low complexity region 1262 1285 N/A INTRINSIC
low complexity region 1337 1356 N/A INTRINSIC
low complexity region 1360 1372 N/A INTRINSIC
low complexity region 1436 1444 N/A INTRINSIC
low complexity region 1547 1560 N/A INTRINSIC
low complexity region 1583 1596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108894
SMART Domains Protein: ENSMUSP00000104522
Gene: ENSMUSG00000037533

DomainStartEndE-ValueType
cNMP 1 113 6.64e-7 SMART
RasGEFN 127 240 4.35e-33 SMART
PDZ 255 327 8.86e-16 SMART
low complexity region 409 420 N/A INTRINSIC
RA 464 550 1.47e-20 SMART
RasGEF 571 810 5.35e-87 SMART
low complexity region 952 965 N/A INTRINSIC
low complexity region 980 997 N/A INTRINSIC
low complexity region 1024 1069 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000114574
Gene: ENSMUSG00000037533
AA Change: D17N

DomainStartEndE-ValueType
low complexity region 47 55 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207429
AA Change: D1412N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0595 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (80/80)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit an inlarged spleen, increased IgE and IgG levels and altered cytokine production. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(13)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,316,464 L23M possibly damaging Het
Acot6 A T 12: 84,106,441 probably null Het
Adamtsl3 A T 7: 82,598,122 N1429Y probably benign Het
Adk T C 14: 21,103,824 S32P possibly damaging Het
Akap13 A T 7: 75,727,038 M2005L probably benign Het
Atp10a A T 7: 58,828,310 D1367V probably benign Het
Bckdhb A G 9: 83,988,862 I142V probably benign Het
Brap C T 5: 121,679,295 Q322* probably null Het
Carmil3 A T 14: 55,496,848 N401I probably damaging Het
Cdan1 A T 2: 120,728,440 S426T possibly damaging Het
Cdc27 C A 11: 104,517,491 S531I probably benign Het
Cela3a A T 4: 137,403,874 Y184* probably null Het
Cep63 T C 9: 102,613,377 K178R probably benign Het
Cfb G A 17: 34,857,314 Q152* probably null Het
Cnpy2 G A 10: 128,326,175 V106I probably benign Het
Cntn1 GCTGTCTTC GC 15: 92,339,523 probably null Het
Ctc1 G A 11: 69,026,219 G67D probably damaging Het
Cwc27 G T 13: 104,804,264 P196T probably benign Het
Cwc27 C A 13: 104,804,268 L194F possibly damaging Het
Cyp2d12 T G 15: 82,555,177 S11A possibly damaging Het
Ddx55 T A 5: 124,559,121 probably null Het
Dedd2 G T 7: 25,218,906 R75S probably damaging Het
Fat2 G A 11: 55,256,704 S3904F possibly damaging Het
Fibp G A 19: 5,463,187 V177I probably damaging Het
Fsip2 A T 2: 82,979,940 E2201V probably benign Het
Gbp11 C T 5: 105,325,062 D499N probably benign Het
Gfm1 A G 3: 67,431,699 E45G probably damaging Het
Gm884 T A 11: 103,616,121 probably benign Het
H2-D1 A G 17: 35,263,511 Y69C probably damaging Het
Hcar1 A G 5: 123,879,046 F194S probably damaging Het
Heatr4 A T 12: 83,977,933 probably null Het
Kcnd2 G A 6: 21,216,696 C133Y probably damaging Het
Kcnq1 A T 7: 143,425,974 Q619L probably benign Het
Kctd12 T A 14: 102,981,465 R326W probably damaging Het
Kel A G 6: 41,689,538 probably null Het
Lipk A T 19: 34,046,797 I332F probably benign Het
Masp2 A G 4: 148,612,059 D371G possibly damaging Het
Met A G 6: 17,571,810 E1376G probably benign Het
Mup5 A T 4: 61,833,778 I78K probably benign Het
Mynn A T 3: 30,616,641 D526V probably damaging Het
Naip6 G T 13: 100,296,915 T1138N possibly damaging Het
Neurod1 G T 2: 79,454,352 P229Q probably damaging Het
Npepps T G 11: 97,248,259 R162S probably damaging Het
Ntrk3 T A 7: 78,462,883 Q175L probably damaging Het
Obsl1 T C 1: 75,503,388 T310A probably damaging Het
Olfr1062 A T 2: 86,423,631 M15K probably benign Het
Olfr1079 A G 2: 86,538,387 I176T probably damaging Het
Olfr1288 A T 2: 111,479,080 T99S probably benign Het
Olfr25 A T 9: 38,330,114 I176F possibly damaging Het
Pigf G A 17: 86,997,536 T193I possibly damaging Het
Pkp4 T C 2: 59,342,181 V904A possibly damaging Het
Plekha6 C T 1: 133,270,040 T141M probably damaging Het
Rhobtb3 T C 13: 75,939,622 D82G probably damaging Het
Rims1 T C 1: 22,428,480 N767S possibly damaging Het
Ripor2 T A 13: 24,665,468 probably benign Het
Sec14l4 T A 11: 4,043,948 I296N probably damaging Het
Serpinb12 G T 1: 106,956,612 V363F probably damaging Het
Serpinb9c A G 13: 33,150,033 I342T probably damaging Het
Shmt2 A G 10: 127,520,076 V133A probably damaging Het
Slc30a6 A G 17: 74,415,666 M243V probably benign Het
Slfn2 T A 11: 83,069,661 N155K probably damaging Het
Syne2 A T 12: 75,854,124 D19V possibly damaging Het
Tcl1b3 A T 12: 105,194,477 I116L probably benign Het
Tcp11 A G 17: 28,067,792 I411T probably damaging Het
Tctn1 C T 5: 122,241,796 A560T probably benign Het
Tenm3 C A 8: 48,229,181 Q2471H probably damaging Het
Tnr A G 1: 159,886,075 D691G probably benign Het
Ube3b C T 5: 114,390,390 P150S probably damaging Het
Ugt2b5 T C 5: 87,139,659 I216M possibly damaging Het
Unc5d T A 8: 28,666,849 R789S probably damaging Het
Ush2a G A 1: 188,415,678 G934D probably damaging Het
Usp6nl A T 2: 6,394,541 R70S probably damaging Het
Vmn1r181 T C 7: 23,984,884 I258T possibly damaging Het
Vmn2r15 C A 5: 109,297,436 D41Y probably damaging Het
Vmn2r17 T A 5: 109,452,825 I663N probably damaging Het
Vnn3 C A 10: 23,865,882 Q362K possibly damaging Het
Wdr72 A G 9: 74,152,448 D380G possibly damaging Het
Wfdc10 G A 2: 164,657,260 E97K possibly damaging Het
Xdh A T 17: 73,899,012 C1002* probably null Het
Zscan4e A C 7: 11,307,651 V126G probably damaging Het
Other mutations in Rapgef6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Rapgef6 APN 11 54679265 missense probably benign 0.00
IGL00507:Rapgef6 APN 11 54664109 nonsense probably null
IGL00809:Rapgef6 APN 11 54649300 missense probably damaging 1.00
IGL00843:Rapgef6 APN 11 54691273 missense probably benign 0.03
IGL00899:Rapgef6 APN 11 54620018 nonsense probably null
IGL01372:Rapgef6 APN 11 54668611 splice site probably benign
IGL01604:Rapgef6 APN 11 54694563 missense probably damaging 0.99
IGL01935:Rapgef6 APN 11 54610842 missense possibly damaging 0.78
IGL01991:Rapgef6 APN 11 54552869 missense probably benign 0.37
IGL02243:Rapgef6 APN 11 54676400 missense probably damaging 1.00
IGL02407:Rapgef6 APN 11 54676355 missense possibly damaging 0.91
IGL02676:Rapgef6 APN 11 54649346 unclassified probably benign
IGL02934:Rapgef6 APN 11 54625864 missense probably damaging 1.00
IGL03076:Rapgef6 APN 11 54625967 missense probably damaging 1.00
IGL03110:Rapgef6 APN 11 54696089 missense probably damaging 0.97
IGL03256:Rapgef6 APN 11 54657429 missense probably damaging 1.00
shocker UTSW 11 54620016 missense probably damaging 1.00
D4216:Rapgef6 UTSW 11 54668746 splice site probably benign
PIT4305001:Rapgef6 UTSW 11 54679377 missense probably damaging 1.00
PIT4366001:Rapgef6 UTSW 11 54691620 missense probably damaging 0.98
R0047:Rapgef6 UTSW 11 54546378 missense possibly damaging 0.65
R0047:Rapgef6 UTSW 11 54546378 missense possibly damaging 0.65
R0125:Rapgef6 UTSW 11 54625875 nonsense probably null
R0189:Rapgef6 UTSW 11 54691249 missense probably benign
R0201:Rapgef6 UTSW 11 54619941 missense probably damaging 1.00
R0505:Rapgef6 UTSW 11 54625963 missense probably benign 0.00
R0524:Rapgef6 UTSW 11 54690284 missense probably benign 0.32
R0853:Rapgef6 UTSW 11 54668677 missense probably damaging 1.00
R1203:Rapgef6 UTSW 11 54691699 missense probably benign 0.09
R1440:Rapgef6 UTSW 11 54626708 missense probably damaging 1.00
R1453:Rapgef6 UTSW 11 54639727 splice site probably null
R1530:Rapgef6 UTSW 11 54661183 missense probably damaging 1.00
R1593:Rapgef6 UTSW 11 54546397 frame shift probably null
R1620:Rapgef6 UTSW 11 54626594 missense possibly damaging 0.88
R1628:Rapgef6 UTSW 11 54546397 frame shift probably null
R1629:Rapgef6 UTSW 11 54546397 frame shift probably null
R1630:Rapgef6 UTSW 11 54546397 frame shift probably null
R1634:Rapgef6 UTSW 11 54546397 frame shift probably null
R1640:Rapgef6 UTSW 11 54657405 missense probably damaging 1.00
R1686:Rapgef6 UTSW 11 54691632 missense possibly damaging 0.81
R1722:Rapgef6 UTSW 11 54546397 frame shift probably null
R1743:Rapgef6 UTSW 11 54676284 missense probably damaging 1.00
R1816:Rapgef6 UTSW 11 54694488 missense probably benign
R1851:Rapgef6 UTSW 11 54642811 missense probably benign 0.01
R1852:Rapgef6 UTSW 11 54642811 missense probably benign 0.01
R1868:Rapgef6 UTSW 11 54546397 frame shift probably null
R1888:Rapgef6 UTSW 11 54660828 missense probably damaging 1.00
R1888:Rapgef6 UTSW 11 54660828 missense probably damaging 1.00
R1942:Rapgef6 UTSW 11 54657263 missense possibly damaging 0.95
R1943:Rapgef6 UTSW 11 54657263 missense possibly damaging 0.95
R2031:Rapgef6 UTSW 11 54552858 missense probably benign 0.30
R2087:Rapgef6 UTSW 11 54631249 missense probably damaging 1.00
R2106:Rapgef6 UTSW 11 54668686 missense probably benign 0.17
R2362:Rapgef6 UTSW 11 54694272 missense probably damaging 1.00
R2484:Rapgef6 UTSW 11 54642756 missense possibly damaging 0.48
R2566:Rapgef6 UTSW 11 54687711 missense possibly damaging 0.66
R2872:Rapgef6 UTSW 11 54661175 missense probably damaging 1.00
R2872:Rapgef6 UTSW 11 54661175 missense probably damaging 1.00
R3744:Rapgef6 UTSW 11 54625934 missense probably benign 0.40
R3848:Rapgef6 UTSW 11 54691308 missense probably damaging 0.97
R4823:Rapgef6 UTSW 11 54694500 missense probably benign 0.08
R4859:Rapgef6 UTSW 11 54636163 missense probably benign
R4906:Rapgef6 UTSW 11 54552836 missense probably damaging 1.00
R4911:Rapgef6 UTSW 11 54622317 missense probably damaging 0.97
R4937:Rapgef6 UTSW 11 54657317 missense probably damaging 1.00
R5033:Rapgef6 UTSW 11 54691381 missense possibly damaging 0.92
R5249:Rapgef6 UTSW 11 54523117 missense probably benign 0.19
R5304:Rapgef6 UTSW 11 54657374 missense probably benign 0.01
R5656:Rapgef6 UTSW 11 54636136 missense possibly damaging 0.95
R5701:Rapgef6 UTSW 11 54676394 missense possibly damaging 0.76
R5758:Rapgef6 UTSW 11 54668644 missense probably damaging 1.00
R5973:Rapgef6 UTSW 11 54639783 missense probably damaging 1.00
R6177:Rapgef6 UTSW 11 54620016 missense probably damaging 1.00
R6268:Rapgef6 UTSW 11 54649247 missense probably damaging 1.00
R6287:Rapgef6 UTSW 11 54626338 splice site probably null
R6293:Rapgef6 UTSW 11 54634781 missense probably damaging 1.00
R6471:Rapgef6 UTSW 11 54691737 missense probably damaging 0.99
R6863:Rapgef6 UTSW 11 54546380 missense probably benign 0.00
R6950:Rapgef6 UTSW 11 54676380 missense probably benign 0.09
R7144:Rapgef6 UTSW 11 54657365 missense possibly damaging 0.78
R7171:Rapgef6 UTSW 11 54676363 missense possibly damaging 0.94
R7199:Rapgef6 UTSW 11 54546426 missense probably benign 0.00
R7291:Rapgef6 UTSW 11 54691239 missense probably benign 0.05
R7436:Rapgef6 UTSW 11 54610921 critical splice donor site probably null
R7498:Rapgef6 UTSW 11 54620004 missense probably damaging 1.00
R7506:Rapgef6 UTSW 11 54636171 missense probably benign 0.00
R7527:Rapgef6 UTSW 11 54634961 missense unknown
R7646:Rapgef6 UTSW 11 54625954 missense probably benign 0.00
R7655:Rapgef6 UTSW 11 54694453 missense probably benign 0.10
R7656:Rapgef6 UTSW 11 54694453 missense probably benign 0.10
R7687:Rapgef6 UTSW 11 54661075 missense possibly damaging 0.93
R7768:Rapgef6 UTSW 11 54626588 missense probably damaging 1.00
R7788:Rapgef6 UTSW 11 54694399 missense probably damaging 1.00
R7890:Rapgef6 UTSW 11 54626723 missense probably damaging 1.00
R8113:Rapgef6 UTSW 11 54625958 missense probably benign 0.03
R8337:Rapgef6 UTSW 11 54631301 nonsense probably null
R8393:Rapgef6 UTSW 11 54687661 missense probably benign
R8492:Rapgef6 UTSW 11 54690237 missense probably damaging 0.99
R8791:Rapgef6 UTSW 11 54568469 missense probably benign 0.15
R8866:Rapgef6 UTSW 11 54552874 critical splice donor site probably null
R8917:Rapgef6 UTSW 11 54691566 nonsense probably null
R8921:Rapgef6 UTSW 11 54679239 missense probably benign 0.09
R9031:Rapgef6 UTSW 11 54687841 missense probably benign 0.00
R9093:Rapgef6 UTSW 11 54597086 nonsense probably null
R9354:Rapgef6 UTSW 11 54619923 missense possibly damaging 0.66
R9514:Rapgef6 UTSW 11 54552858 missense probably benign 0.14
R9516:Rapgef6 UTSW 11 54691343 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCCGTGTCTTATCAAGGG -3'
(R):5'- TGGTGCACTTTCCAACACCC -3'

Sequencing Primer
(F):5'- ATCTTCTCTGAGCAGCGAAG -3'
(R):5'- CTCCGCTTAACTGTCCCGTAG -3'
Posted On 2021-01-18