Incidental Mutation 'R8465:Rapgef6'
ID 656782
Institutional Source Beutler Lab
Gene Symbol Rapgef6
Ensembl Gene ENSMUSG00000037533
Gene Name Rap guanine nucleotide exchange factor (GEF) 6
Synonyms PDZ-GEF2, C030018K18Rik, Pdzgef2, RA-GEF-2
MMRRC Submission 067909-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8465 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 54413673-54590111 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 54582308 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 1407 (D1407N)
Ref Sequence ENSEMBL: ENSMUSP00000099804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094536] [ENSMUST00000101206] [ENSMUST00000102743] [ENSMUST00000108894] [ENSMUST00000207429]
AlphaFold Q5NCJ1
Predicted Effect probably benign
Transcript: ENSMUST00000094536
SMART Domains Protein: ENSMUSP00000092114
Gene: ENSMUSG00000037533

DomainStartEndE-ValueType
cNMP 1 113 6.64e-7 SMART
RasGEFN 127 240 4.35e-33 SMART
PDZ 255 327 8.86e-16 SMART
low complexity region 409 420 N/A INTRINSIC
RA 464 550 1.47e-20 SMART
RasGEF 571 853 3.88e-84 SMART
low complexity region 944 957 N/A INTRINSIC
low complexity region 972 989 N/A INTRINSIC
low complexity region 1016 1061 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101206
AA Change: D1415N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000098766
Gene: ENSMUSG00000037533
AA Change: D1415N

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.45e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 525 4.35e-33 SMART
PDZ 540 612 8.86e-16 SMART
low complexity region 694 705 N/A INTRINSIC
RA 749 835 1.47e-20 SMART
RasGEF 856 1095 5.35e-87 SMART
low complexity region 1237 1250 N/A INTRINSIC
low complexity region 1270 1293 N/A INTRINSIC
low complexity region 1345 1364 N/A INTRINSIC
low complexity region 1368 1380 N/A INTRINSIC
low complexity region 1444 1452 N/A INTRINSIC
low complexity region 1555 1568 N/A INTRINSIC
low complexity region 1591 1604 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102743
AA Change: D1407N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099804
Gene: ENSMUSG00000037533
AA Change: D1407N

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.42e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 525 4.35e-33 SMART
PDZ 540 612 8.86e-16 SMART
low complexity region 694 705 N/A INTRINSIC
RA 749 835 1.47e-20 SMART
RasGEF 856 1138 3.88e-84 SMART
low complexity region 1229 1242 N/A INTRINSIC
low complexity region 1262 1285 N/A INTRINSIC
low complexity region 1337 1356 N/A INTRINSIC
low complexity region 1360 1372 N/A INTRINSIC
low complexity region 1436 1444 N/A INTRINSIC
low complexity region 1547 1560 N/A INTRINSIC
low complexity region 1583 1596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108894
SMART Domains Protein: ENSMUSP00000104522
Gene: ENSMUSG00000037533

DomainStartEndE-ValueType
cNMP 1 113 6.64e-7 SMART
RasGEFN 127 240 4.35e-33 SMART
PDZ 255 327 8.86e-16 SMART
low complexity region 409 420 N/A INTRINSIC
RA 464 550 1.47e-20 SMART
RasGEF 571 810 5.35e-87 SMART
low complexity region 952 965 N/A INTRINSIC
low complexity region 980 997 N/A INTRINSIC
low complexity region 1024 1069 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000114574
Gene: ENSMUSG00000037533
AA Change: D17N

DomainStartEndE-ValueType
low complexity region 47 55 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207429
AA Change: D1412N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0595 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (80/80)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit an inlarged spleen, increased IgE and IgG levels and altered cytokine production. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(13)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot6 A T 12: 84,153,215 (GRCm39) probably null Het
Adamtsl3 A T 7: 82,247,330 (GRCm39) N1429Y probably benign Het
Adk T C 14: 21,153,892 (GRCm39) S32P possibly damaging Het
Akap13 A T 7: 75,376,786 (GRCm39) M2005L probably benign Het
Atp10a A T 7: 58,478,058 (GRCm39) D1367V probably benign Het
Bckdhb A G 9: 83,870,915 (GRCm39) I142V probably benign Het
Brap C T 5: 121,817,358 (GRCm39) Q322* probably null Het
Carmil3 A T 14: 55,734,305 (GRCm39) N401I probably damaging Het
Cdan1 A T 2: 120,558,921 (GRCm39) S426T possibly damaging Het
Cdc27 C A 11: 104,408,317 (GRCm39) S531I probably benign Het
Cela3a A T 4: 137,131,185 (GRCm39) Y184* probably null Het
Cep63 T C 9: 102,490,576 (GRCm39) K178R probably benign Het
Cfb G A 17: 35,076,290 (GRCm39) Q152* probably null Het
Cnpy2 G A 10: 128,162,044 (GRCm39) V106I probably benign Het
Cntn1 GCTGTCTTC GC 15: 92,237,404 (GRCm39) probably null Het
Ctc1 G A 11: 68,917,045 (GRCm39) G67D probably damaging Het
Cwc27 G T 13: 104,940,772 (GRCm39) P196T probably benign Het
Cwc27 C A 13: 104,940,776 (GRCm39) L194F possibly damaging Het
Cyp2d12 T G 15: 82,439,378 (GRCm39) S11A possibly damaging Het
Ddx55 T A 5: 124,697,184 (GRCm39) probably null Het
Dedd2 G T 7: 24,918,331 (GRCm39) R75S probably damaging Het
Fat2 G A 11: 55,147,530 (GRCm39) S3904F possibly damaging Het
Fibp G A 19: 5,513,215 (GRCm39) V177I probably damaging Het
Fsip2 A T 2: 82,810,284 (GRCm39) E2201V probably benign Het
Gbp11 C T 5: 105,472,928 (GRCm39) D499N probably benign Het
Gfm1 A G 3: 67,339,032 (GRCm39) E45G probably damaging Het
H2-D1 A G 17: 35,482,487 (GRCm39) Y69C probably damaging Het
Hcar1 A G 5: 124,017,109 (GRCm39) F194S probably damaging Het
Heatr4 A T 12: 84,024,707 (GRCm39) probably null Het
Kcnd2 G A 6: 21,216,695 (GRCm39) C133Y probably damaging Het
Kcnq1 A T 7: 142,979,711 (GRCm39) Q619L probably benign Het
Kctd12 T A 14: 103,218,901 (GRCm39) R326W probably damaging Het
Kel A G 6: 41,666,472 (GRCm39) probably null Het
Lipk A T 19: 34,024,197 (GRCm39) I332F probably benign Het
Lrrc37 T A 11: 103,506,947 (GRCm39) probably benign Het
Masp2 A G 4: 148,696,516 (GRCm39) D371G possibly damaging Het
Met A G 6: 17,571,809 (GRCm39) E1376G probably benign Het
Mup5 A T 4: 61,752,015 (GRCm39) I78K probably benign Het
Mynn A T 3: 30,670,790 (GRCm39) D526V probably damaging Het
Naip6 G T 13: 100,433,423 (GRCm39) T1138N possibly damaging Het
Neurod1 G T 2: 79,284,696 (GRCm39) P229Q probably damaging Het
Npepps T G 11: 97,139,085 (GRCm39) R162S probably damaging Het
Ntrk3 T A 7: 78,112,631 (GRCm39) Q175L probably damaging Het
Obsl1 T C 1: 75,480,032 (GRCm39) T310A probably damaging Het
Or4g7 A T 2: 111,309,425 (GRCm39) T99S probably benign Het
Or8c9 A T 9: 38,241,410 (GRCm39) I176F possibly damaging Het
Or8j3c A T 2: 86,253,975 (GRCm39) M15K probably benign Het
Or8k32 A G 2: 86,368,731 (GRCm39) I176T probably damaging Het
Pigf G A 17: 87,304,964 (GRCm39) T193I possibly damaging Het
Pkp4 T C 2: 59,172,525 (GRCm39) V904A possibly damaging Het
Plekha6 C T 1: 133,197,778 (GRCm39) T141M probably damaging Het
Rhobtb3 T C 13: 76,087,741 (GRCm39) D82G probably damaging Het
Rims1 T C 1: 22,498,731 (GRCm39) N767S possibly damaging Het
Ripor2 T A 13: 24,849,451 (GRCm39) probably benign Het
Sec14l4 T A 11: 3,993,948 (GRCm39) I296N probably damaging Het
Serpinb12 G T 1: 106,884,342 (GRCm39) V363F probably damaging Het
Serpinb9c A G 13: 33,334,016 (GRCm39) I342T probably damaging Het
Shmt2 A G 10: 127,355,945 (GRCm39) V133A probably damaging Het
Slc30a6 A G 17: 74,722,661 (GRCm39) M243V probably benign Het
Slfn2 T A 11: 82,960,487 (GRCm39) N155K probably damaging Het
Spata31h1 A T 10: 82,152,298 (GRCm39) L23M possibly damaging Het
Syne2 A T 12: 75,900,898 (GRCm39) D19V possibly damaging Het
Tcl1b3 A T 12: 105,160,736 (GRCm39) I116L probably benign Het
Tcp11 A G 17: 28,286,766 (GRCm39) I411T probably damaging Het
Tctn1 C T 5: 122,379,859 (GRCm39) A560T probably benign Het
Tenm3 C A 8: 48,682,216 (GRCm39) Q2471H probably damaging Het
Tnr A G 1: 159,713,645 (GRCm39) D691G probably benign Het
Ube3b C T 5: 114,528,451 (GRCm39) P150S probably damaging Het
Ugt2b5 T C 5: 87,287,518 (GRCm39) I216M possibly damaging Het
Unc5d T A 8: 29,156,877 (GRCm39) R789S probably damaging Het
Ush2a G A 1: 188,147,875 (GRCm39) G934D probably damaging Het
Usp6nl A T 2: 6,399,352 (GRCm39) R70S probably damaging Het
Vmn1r181 T C 7: 23,684,309 (GRCm39) I258T possibly damaging Het
Vmn2r15 C A 5: 109,445,302 (GRCm39) D41Y probably damaging Het
Vmn2r17 T A 5: 109,600,691 (GRCm39) I663N probably damaging Het
Vnn3 C A 10: 23,741,780 (GRCm39) Q362K possibly damaging Het
Wdr72 A G 9: 74,059,730 (GRCm39) D380G possibly damaging Het
Wfdc10 G A 2: 164,499,180 (GRCm39) E97K possibly damaging Het
Xdh A T 17: 74,206,007 (GRCm39) C1002* probably null Het
Zscan4e A C 7: 11,041,578 (GRCm39) V126G probably damaging Het
Other mutations in Rapgef6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Rapgef6 APN 11 54,570,091 (GRCm39) missense probably benign 0.00
IGL00507:Rapgef6 APN 11 54,554,935 (GRCm39) nonsense probably null
IGL00809:Rapgef6 APN 11 54,540,126 (GRCm39) missense probably damaging 1.00
IGL00843:Rapgef6 APN 11 54,582,099 (GRCm39) missense probably benign 0.03
IGL00899:Rapgef6 APN 11 54,510,844 (GRCm39) nonsense probably null
IGL01372:Rapgef6 APN 11 54,559,437 (GRCm39) splice site probably benign
IGL01604:Rapgef6 APN 11 54,585,389 (GRCm39) missense probably damaging 0.99
IGL01935:Rapgef6 APN 11 54,501,668 (GRCm39) missense possibly damaging 0.78
IGL01991:Rapgef6 APN 11 54,443,695 (GRCm39) missense probably benign 0.37
IGL02243:Rapgef6 APN 11 54,567,226 (GRCm39) missense probably damaging 1.00
IGL02407:Rapgef6 APN 11 54,567,181 (GRCm39) missense possibly damaging 0.91
IGL02676:Rapgef6 APN 11 54,540,172 (GRCm39) unclassified probably benign
IGL02934:Rapgef6 APN 11 54,516,690 (GRCm39) missense probably damaging 1.00
IGL03076:Rapgef6 APN 11 54,516,793 (GRCm39) missense probably damaging 1.00
IGL03110:Rapgef6 APN 11 54,586,915 (GRCm39) missense probably damaging 0.97
IGL03256:Rapgef6 APN 11 54,548,255 (GRCm39) missense probably damaging 1.00
shocker UTSW 11 54,510,842 (GRCm39) missense probably damaging 1.00
D4216:Rapgef6 UTSW 11 54,559,572 (GRCm39) splice site probably benign
PIT4305001:Rapgef6 UTSW 11 54,570,203 (GRCm39) missense probably damaging 1.00
PIT4366001:Rapgef6 UTSW 11 54,582,446 (GRCm39) missense probably damaging 0.98
R0047:Rapgef6 UTSW 11 54,437,204 (GRCm39) missense possibly damaging 0.65
R0047:Rapgef6 UTSW 11 54,437,204 (GRCm39) missense possibly damaging 0.65
R0125:Rapgef6 UTSW 11 54,516,701 (GRCm39) nonsense probably null
R0189:Rapgef6 UTSW 11 54,582,075 (GRCm39) missense probably benign
R0201:Rapgef6 UTSW 11 54,510,767 (GRCm39) missense probably damaging 1.00
R0505:Rapgef6 UTSW 11 54,516,789 (GRCm39) missense probably benign 0.00
R0524:Rapgef6 UTSW 11 54,581,110 (GRCm39) missense probably benign 0.32
R0853:Rapgef6 UTSW 11 54,559,503 (GRCm39) missense probably damaging 1.00
R1203:Rapgef6 UTSW 11 54,582,525 (GRCm39) missense probably benign 0.09
R1440:Rapgef6 UTSW 11 54,517,534 (GRCm39) missense probably damaging 1.00
R1453:Rapgef6 UTSW 11 54,530,553 (GRCm39) splice site probably null
R1530:Rapgef6 UTSW 11 54,552,009 (GRCm39) missense probably damaging 1.00
R1593:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1620:Rapgef6 UTSW 11 54,517,420 (GRCm39) missense possibly damaging 0.88
R1628:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1629:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1630:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1634:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1640:Rapgef6 UTSW 11 54,548,231 (GRCm39) missense probably damaging 1.00
R1686:Rapgef6 UTSW 11 54,582,458 (GRCm39) missense possibly damaging 0.81
R1722:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1743:Rapgef6 UTSW 11 54,567,110 (GRCm39) missense probably damaging 1.00
R1816:Rapgef6 UTSW 11 54,585,314 (GRCm39) missense probably benign
R1851:Rapgef6 UTSW 11 54,533,637 (GRCm39) missense probably benign 0.01
R1852:Rapgef6 UTSW 11 54,533,637 (GRCm39) missense probably benign 0.01
R1868:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1888:Rapgef6 UTSW 11 54,551,654 (GRCm39) missense probably damaging 1.00
R1888:Rapgef6 UTSW 11 54,551,654 (GRCm39) missense probably damaging 1.00
R1942:Rapgef6 UTSW 11 54,548,089 (GRCm39) missense possibly damaging 0.95
R1943:Rapgef6 UTSW 11 54,548,089 (GRCm39) missense possibly damaging 0.95
R2031:Rapgef6 UTSW 11 54,443,684 (GRCm39) missense probably benign 0.30
R2087:Rapgef6 UTSW 11 54,522,075 (GRCm39) missense probably damaging 1.00
R2106:Rapgef6 UTSW 11 54,559,512 (GRCm39) missense probably benign 0.17
R2362:Rapgef6 UTSW 11 54,585,098 (GRCm39) missense probably damaging 1.00
R2484:Rapgef6 UTSW 11 54,533,582 (GRCm39) missense possibly damaging 0.48
R2566:Rapgef6 UTSW 11 54,578,537 (GRCm39) missense possibly damaging 0.66
R2872:Rapgef6 UTSW 11 54,552,001 (GRCm39) missense probably damaging 1.00
R2872:Rapgef6 UTSW 11 54,552,001 (GRCm39) missense probably damaging 1.00
R3744:Rapgef6 UTSW 11 54,516,760 (GRCm39) missense probably benign 0.40
R3848:Rapgef6 UTSW 11 54,582,134 (GRCm39) missense probably damaging 0.97
R4823:Rapgef6 UTSW 11 54,585,326 (GRCm39) missense probably benign 0.08
R4859:Rapgef6 UTSW 11 54,526,989 (GRCm39) missense probably benign
R4906:Rapgef6 UTSW 11 54,443,662 (GRCm39) missense probably damaging 1.00
R4911:Rapgef6 UTSW 11 54,513,143 (GRCm39) missense probably damaging 0.97
R4937:Rapgef6 UTSW 11 54,548,143 (GRCm39) missense probably damaging 1.00
R5033:Rapgef6 UTSW 11 54,582,207 (GRCm39) missense possibly damaging 0.92
R5249:Rapgef6 UTSW 11 54,413,943 (GRCm39) missense probably benign 0.19
R5304:Rapgef6 UTSW 11 54,548,200 (GRCm39) missense probably benign 0.01
R5656:Rapgef6 UTSW 11 54,526,962 (GRCm39) missense possibly damaging 0.95
R5701:Rapgef6 UTSW 11 54,567,220 (GRCm39) missense possibly damaging 0.76
R5758:Rapgef6 UTSW 11 54,559,470 (GRCm39) missense probably damaging 1.00
R5973:Rapgef6 UTSW 11 54,530,609 (GRCm39) missense probably damaging 1.00
R6177:Rapgef6 UTSW 11 54,510,842 (GRCm39) missense probably damaging 1.00
R6268:Rapgef6 UTSW 11 54,540,073 (GRCm39) missense probably damaging 1.00
R6287:Rapgef6 UTSW 11 54,517,164 (GRCm39) splice site probably null
R6293:Rapgef6 UTSW 11 54,525,607 (GRCm39) missense probably damaging 1.00
R6471:Rapgef6 UTSW 11 54,582,563 (GRCm39) missense probably damaging 0.99
R6863:Rapgef6 UTSW 11 54,437,206 (GRCm39) missense probably benign 0.00
R6950:Rapgef6 UTSW 11 54,567,206 (GRCm39) missense probably benign 0.09
R7144:Rapgef6 UTSW 11 54,548,191 (GRCm39) missense possibly damaging 0.78
R7171:Rapgef6 UTSW 11 54,567,189 (GRCm39) missense possibly damaging 0.94
R7199:Rapgef6 UTSW 11 54,437,252 (GRCm39) missense probably benign 0.00
R7291:Rapgef6 UTSW 11 54,582,065 (GRCm39) missense probably benign 0.05
R7436:Rapgef6 UTSW 11 54,501,747 (GRCm39) critical splice donor site probably null
R7498:Rapgef6 UTSW 11 54,510,830 (GRCm39) missense probably damaging 1.00
R7506:Rapgef6 UTSW 11 54,526,997 (GRCm39) missense probably benign 0.00
R7527:Rapgef6 UTSW 11 54,525,787 (GRCm39) missense unknown
R7646:Rapgef6 UTSW 11 54,516,780 (GRCm39) missense probably benign 0.00
R7655:Rapgef6 UTSW 11 54,585,279 (GRCm39) missense probably benign 0.10
R7656:Rapgef6 UTSW 11 54,585,279 (GRCm39) missense probably benign 0.10
R7687:Rapgef6 UTSW 11 54,551,901 (GRCm39) missense possibly damaging 0.93
R7768:Rapgef6 UTSW 11 54,517,414 (GRCm39) missense probably damaging 1.00
R7788:Rapgef6 UTSW 11 54,585,225 (GRCm39) missense probably damaging 1.00
R7890:Rapgef6 UTSW 11 54,517,549 (GRCm39) missense probably damaging 1.00
R8113:Rapgef6 UTSW 11 54,516,784 (GRCm39) missense probably benign 0.03
R8337:Rapgef6 UTSW 11 54,522,127 (GRCm39) nonsense probably null
R8393:Rapgef6 UTSW 11 54,578,487 (GRCm39) missense probably benign
R8492:Rapgef6 UTSW 11 54,581,063 (GRCm39) missense probably damaging 0.99
R8791:Rapgef6 UTSW 11 54,459,295 (GRCm39) missense probably benign 0.15
R8866:Rapgef6 UTSW 11 54,443,700 (GRCm39) critical splice donor site probably null
R8917:Rapgef6 UTSW 11 54,582,392 (GRCm39) nonsense probably null
R8921:Rapgef6 UTSW 11 54,570,065 (GRCm39) missense probably benign 0.09
R9031:Rapgef6 UTSW 11 54,578,667 (GRCm39) missense probably benign 0.00
R9093:Rapgef6 UTSW 11 54,487,912 (GRCm39) nonsense probably null
R9354:Rapgef6 UTSW 11 54,510,749 (GRCm39) missense possibly damaging 0.66
R9514:Rapgef6 UTSW 11 54,443,684 (GRCm39) missense probably benign 0.14
R9516:Rapgef6 UTSW 11 54,582,169 (GRCm39) missense probably damaging 1.00
R9739:Rapgef6 UTSW 11 54,513,189 (GRCm39) missense probably benign 0.03
R9789:Rapgef6 UTSW 11 54,540,097 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AAGCCGTGTCTTATCAAGGG -3'
(R):5'- TGGTGCACTTTCCAACACCC -3'

Sequencing Primer
(F):5'- ATCTTCTCTGAGCAGCGAAG -3'
(R):5'- CTCCGCTTAACTGTCCCGTAG -3'
Posted On 2021-01-18