Incidental Mutation 'R8465:Heatr4'
ID 656790
Institutional Source Beutler Lab
Gene Symbol Heatr4
Ensembl Gene ENSMUSG00000090843
Gene Name HEAT repeat containing 4
Synonyms Gm17673
MMRRC Submission 067909-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R8465 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 83954499-83984852 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 83977933 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164935]
AlphaFold E9Q357
Predicted Effect probably null
Transcript: ENSMUST00000164935
SMART Domains Protein: ENSMUSP00000129832
Gene: ENSMUSG00000090843

DomainStartEndE-ValueType
low complexity region 153 166 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
low complexity region 289 303 N/A INTRINSIC
low complexity region 533 548 N/A INTRINSIC
internal_repeat_1 577 711 2.78e-6 PROSPERO
Pfam:HEAT_2 776 890 1.8e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (80/80)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,316,464 L23M possibly damaging Het
Acot6 A T 12: 84,106,441 probably null Het
Adamtsl3 A T 7: 82,598,122 N1429Y probably benign Het
Adk T C 14: 21,103,824 S32P possibly damaging Het
Akap13 A T 7: 75,727,038 M2005L probably benign Het
Atp10a A T 7: 58,828,310 D1367V probably benign Het
Bckdhb A G 9: 83,988,862 I142V probably benign Het
Brap C T 5: 121,679,295 Q322* probably null Het
Carmil3 A T 14: 55,496,848 N401I probably damaging Het
Cdan1 A T 2: 120,728,440 S426T possibly damaging Het
Cdc27 C A 11: 104,517,491 S531I probably benign Het
Cela3a A T 4: 137,403,874 Y184* probably null Het
Cep63 T C 9: 102,613,377 K178R probably benign Het
Cfb G A 17: 34,857,314 Q152* probably null Het
Cnpy2 G A 10: 128,326,175 V106I probably benign Het
Cntn1 GCTGTCTTC GC 15: 92,339,523 probably null Het
Ctc1 G A 11: 69,026,219 G67D probably damaging Het
Cwc27 C A 13: 104,804,268 L194F possibly damaging Het
Cwc27 G T 13: 104,804,264 P196T probably benign Het
Cyp2d12 T G 15: 82,555,177 S11A possibly damaging Het
Ddx55 T A 5: 124,559,121 probably null Het
Dedd2 G T 7: 25,218,906 R75S probably damaging Het
Fat2 G A 11: 55,256,704 S3904F possibly damaging Het
Fibp G A 19: 5,463,187 V177I probably damaging Het
Fsip2 A T 2: 82,979,940 E2201V probably benign Het
Gbp11 C T 5: 105,325,062 D499N probably benign Het
Gfm1 A G 3: 67,431,699 E45G probably damaging Het
Gm884 T A 11: 103,616,121 probably benign Het
H2-D1 A G 17: 35,263,511 Y69C probably damaging Het
Hcar1 A G 5: 123,879,046 F194S probably damaging Het
Kcnd2 G A 6: 21,216,696 C133Y probably damaging Het
Kcnq1 A T 7: 143,425,974 Q619L probably benign Het
Kctd12 T A 14: 102,981,465 R326W probably damaging Het
Kel A G 6: 41,689,538 probably null Het
Lipk A T 19: 34,046,797 I332F probably benign Het
Masp2 A G 4: 148,612,059 D371G possibly damaging Het
Met A G 6: 17,571,810 E1376G probably benign Het
Mup5 A T 4: 61,833,778 I78K probably benign Het
Mynn A T 3: 30,616,641 D526V probably damaging Het
Naip6 G T 13: 100,296,915 T1138N possibly damaging Het
Neurod1 G T 2: 79,454,352 P229Q probably damaging Het
Npepps T G 11: 97,248,259 R162S probably damaging Het
Ntrk3 T A 7: 78,462,883 Q175L probably damaging Het
Obsl1 T C 1: 75,503,388 T310A probably damaging Het
Olfr1062 A T 2: 86,423,631 M15K probably benign Het
Olfr1079 A G 2: 86,538,387 I176T probably damaging Het
Olfr1288 A T 2: 111,479,080 T99S probably benign Het
Olfr25 A T 9: 38,330,114 I176F possibly damaging Het
Pigf G A 17: 86,997,536 T193I possibly damaging Het
Pkp4 T C 2: 59,342,181 V904A possibly damaging Het
Plekha6 C T 1: 133,270,040 T141M probably damaging Het
Rapgef6 G A 11: 54,691,482 D1407N probably benign Het
Rhobtb3 T C 13: 75,939,622 D82G probably damaging Het
Rims1 T C 1: 22,428,480 N767S possibly damaging Het
Ripor2 T A 13: 24,665,468 probably benign Het
Sec14l4 T A 11: 4,043,948 I296N probably damaging Het
Serpinb12 G T 1: 106,956,612 V363F probably damaging Het
Serpinb9c A G 13: 33,150,033 I342T probably damaging Het
Shmt2 A G 10: 127,520,076 V133A probably damaging Het
Slc30a6 A G 17: 74,415,666 M243V probably benign Het
Slfn2 T A 11: 83,069,661 N155K probably damaging Het
Syne2 A T 12: 75,854,124 D19V possibly damaging Het
Tcl1b3 A T 12: 105,194,477 I116L probably benign Het
Tcp11 A G 17: 28,067,792 I411T probably damaging Het
Tctn1 C T 5: 122,241,796 A560T probably benign Het
Tenm3 C A 8: 48,229,181 Q2471H probably damaging Het
Tnr A G 1: 159,886,075 D691G probably benign Het
Ube3b C T 5: 114,390,390 P150S probably damaging Het
Ugt2b5 T C 5: 87,139,659 I216M possibly damaging Het
Unc5d T A 8: 28,666,849 R789S probably damaging Het
Ush2a G A 1: 188,415,678 G934D probably damaging Het
Usp6nl A T 2: 6,394,541 R70S probably damaging Het
Vmn1r181 T C 7: 23,984,884 I258T possibly damaging Het
Vmn2r15 C A 5: 109,297,436 D41Y probably damaging Het
Vmn2r17 T A 5: 109,452,825 I663N probably damaging Het
Vnn3 C A 10: 23,865,882 Q362K possibly damaging Het
Wdr72 A G 9: 74,152,448 D380G possibly damaging Het
Wfdc10 G A 2: 164,657,260 E97K possibly damaging Het
Xdh A T 17: 73,899,012 C1002* probably null Het
Zscan4e A C 7: 11,307,651 V126G probably damaging Het
Other mutations in Heatr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1070:Heatr4 UTSW 12 83978067 missense possibly damaging 0.70
R1225:Heatr4 UTSW 12 83978046 missense probably benign 0.01
R1398:Heatr4 UTSW 12 83967621 missense possibly damaging 0.45
R1467:Heatr4 UTSW 12 83978067 missense possibly damaging 0.70
R1467:Heatr4 UTSW 12 83978067 missense possibly damaging 0.70
R1626:Heatr4 UTSW 12 83973721 missense probably benign 0.00
R1728:Heatr4 UTSW 12 83967572 missense probably benign 0.03
R1779:Heatr4 UTSW 12 83980160 missense probably benign 0.30
R1784:Heatr4 UTSW 12 83967572 missense probably benign 0.03
R1860:Heatr4 UTSW 12 83979728 nonsense probably null
R1903:Heatr4 UTSW 12 83958447 missense probably damaging 1.00
R1916:Heatr4 UTSW 12 83955817 missense probably benign 0.21
R1972:Heatr4 UTSW 12 83955020 missense probably damaging 1.00
R2008:Heatr4 UTSW 12 83979740 missense probably benign 0.01
R2081:Heatr4 UTSW 12 83980322 missense probably damaging 0.99
R2093:Heatr4 UTSW 12 83975081 missense possibly damaging 0.63
R2399:Heatr4 UTSW 12 83980333 missense probably benign 0.00
R2680:Heatr4 UTSW 12 83980463 missense possibly damaging 0.91
R4618:Heatr4 UTSW 12 83978067 missense probably damaging 1.00
R6400:Heatr4 UTSW 12 83955010 missense probably null 1.00
R6527:Heatr4 UTSW 12 83979763 missense probably damaging 1.00
R6616:Heatr4 UTSW 12 83980130 missense probably benign
R6815:Heatr4 UTSW 12 83979727 missense probably damaging 0.96
R7070:Heatr4 UTSW 12 83969858 missense probably benign
R7219:Heatr4 UTSW 12 83957870 missense possibly damaging 0.89
R7329:Heatr4 UTSW 12 83978082 missense probably benign 0.00
R7477:Heatr4 UTSW 12 83979830 missense probably damaging 0.97
R7570:Heatr4 UTSW 12 83979644 missense probably benign 0.10
R7709:Heatr4 UTSW 12 83957725 missense probably damaging 0.98
R8280:Heatr4 UTSW 12 83969896 missense probably benign
R8423:Heatr4 UTSW 12 83980330 missense probably benign 0.04
R8515:Heatr4 UTSW 12 83954704 missense probably damaging 1.00
R8694:Heatr4 UTSW 12 83980264 missense probably damaging 1.00
R8947:Heatr4 UTSW 12 83954657 missense probably benign
R9585:Heatr4 UTSW 12 83967698 missense probably damaging 0.99
R9717:Heatr4 UTSW 12 83978055 missense probably damaging 1.00
Z1177:Heatr4 UTSW 12 83980478 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGTCCTCCCAAAGTCAGCTG -3'
(R):5'- TACCTGGTTACTCCCCACAAG -3'

Sequencing Primer
(F):5'- TGGGACTCACGAGCCTATC -3'
(R):5'- GTACACACAGCTGAAGCCATGTC -3'
Posted On 2021-01-18