Incidental Mutation 'R8465:Cwc27'
ID 656796
Institutional Source Beutler Lab
Gene Symbol Cwc27
Ensembl Gene ENSMUSG00000021715
Gene Name CWC27 spliceosome-associated protein
Synonyms NY-CO-10, 3110009E13Rik, Sdccag10
MMRRC Submission 067909-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8465 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 104767648-104953649 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 104940772 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Threonine at position 196 (P196T)
Ref Sequence ENSEMBL: ENSMUSP00000022228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022228] [ENSMUST00000154165]
AlphaFold Q3TKY6
Predicted Effect probably benign
Transcript: ENSMUST00000022228
AA Change: P196T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022228
Gene: ENSMUSG00000021715
AA Change: P196T

DomainStartEndE-ValueType
Pfam:Pro_isomerase 14 166 3.4e-47 PFAM
low complexity region 176 197 N/A INTRINSIC
low complexity region 209 217 N/A INTRINSIC
coiled coil region 309 341 N/A INTRINSIC
low complexity region 452 469 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154165
SMART Domains Protein: ENSMUSP00000119076
Gene: ENSMUSG00000021715

DomainStartEndE-ValueType
Pfam:Pro_isomerase 14 82 1.3e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (80/80)
MGI Phenotype PHENOTYPE: Homozygous mutant mice exhibit reduced viability. Surviors after birth show signs of growth retardation and retinal depigmentation, along with numerous neurological, immunological, and blood chemistry abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot6 A T 12: 84,153,215 (GRCm39) probably null Het
Adamtsl3 A T 7: 82,247,330 (GRCm39) N1429Y probably benign Het
Adk T C 14: 21,153,892 (GRCm39) S32P possibly damaging Het
Akap13 A T 7: 75,376,786 (GRCm39) M2005L probably benign Het
Atp10a A T 7: 58,478,058 (GRCm39) D1367V probably benign Het
Bckdhb A G 9: 83,870,915 (GRCm39) I142V probably benign Het
Brap C T 5: 121,817,358 (GRCm39) Q322* probably null Het
Carmil3 A T 14: 55,734,305 (GRCm39) N401I probably damaging Het
Cdan1 A T 2: 120,558,921 (GRCm39) S426T possibly damaging Het
Cdc27 C A 11: 104,408,317 (GRCm39) S531I probably benign Het
Cela3a A T 4: 137,131,185 (GRCm39) Y184* probably null Het
Cep63 T C 9: 102,490,576 (GRCm39) K178R probably benign Het
Cfb G A 17: 35,076,290 (GRCm39) Q152* probably null Het
Cnpy2 G A 10: 128,162,044 (GRCm39) V106I probably benign Het
Cntn1 GCTGTCTTC GC 15: 92,237,404 (GRCm39) probably null Het
Ctc1 G A 11: 68,917,045 (GRCm39) G67D probably damaging Het
Cyp2d12 T G 15: 82,439,378 (GRCm39) S11A possibly damaging Het
Ddx55 T A 5: 124,697,184 (GRCm39) probably null Het
Dedd2 G T 7: 24,918,331 (GRCm39) R75S probably damaging Het
Fat2 G A 11: 55,147,530 (GRCm39) S3904F possibly damaging Het
Fibp G A 19: 5,513,215 (GRCm39) V177I probably damaging Het
Fsip2 A T 2: 82,810,284 (GRCm39) E2201V probably benign Het
Gbp11 C T 5: 105,472,928 (GRCm39) D499N probably benign Het
Gfm1 A G 3: 67,339,032 (GRCm39) E45G probably damaging Het
H2-D1 A G 17: 35,482,487 (GRCm39) Y69C probably damaging Het
Hcar1 A G 5: 124,017,109 (GRCm39) F194S probably damaging Het
Heatr4 A T 12: 84,024,707 (GRCm39) probably null Het
Kcnd2 G A 6: 21,216,695 (GRCm39) C133Y probably damaging Het
Kcnq1 A T 7: 142,979,711 (GRCm39) Q619L probably benign Het
Kctd12 T A 14: 103,218,901 (GRCm39) R326W probably damaging Het
Kel A G 6: 41,666,472 (GRCm39) probably null Het
Lipk A T 19: 34,024,197 (GRCm39) I332F probably benign Het
Lrrc37 T A 11: 103,506,947 (GRCm39) probably benign Het
Masp2 A G 4: 148,696,516 (GRCm39) D371G possibly damaging Het
Met A G 6: 17,571,809 (GRCm39) E1376G probably benign Het
Mup5 A T 4: 61,752,015 (GRCm39) I78K probably benign Het
Mynn A T 3: 30,670,790 (GRCm39) D526V probably damaging Het
Naip6 G T 13: 100,433,423 (GRCm39) T1138N possibly damaging Het
Neurod1 G T 2: 79,284,696 (GRCm39) P229Q probably damaging Het
Npepps T G 11: 97,139,085 (GRCm39) R162S probably damaging Het
Ntrk3 T A 7: 78,112,631 (GRCm39) Q175L probably damaging Het
Obsl1 T C 1: 75,480,032 (GRCm39) T310A probably damaging Het
Or4g7 A T 2: 111,309,425 (GRCm39) T99S probably benign Het
Or8c9 A T 9: 38,241,410 (GRCm39) I176F possibly damaging Het
Or8j3c A T 2: 86,253,975 (GRCm39) M15K probably benign Het
Or8k32 A G 2: 86,368,731 (GRCm39) I176T probably damaging Het
Pigf G A 17: 87,304,964 (GRCm39) T193I possibly damaging Het
Pkp4 T C 2: 59,172,525 (GRCm39) V904A possibly damaging Het
Plekha6 C T 1: 133,197,778 (GRCm39) T141M probably damaging Het
Rapgef6 G A 11: 54,582,308 (GRCm39) D1407N probably benign Het
Rhobtb3 T C 13: 76,087,741 (GRCm39) D82G probably damaging Het
Rims1 T C 1: 22,498,731 (GRCm39) N767S possibly damaging Het
Ripor2 T A 13: 24,849,451 (GRCm39) probably benign Het
Sec14l4 T A 11: 3,993,948 (GRCm39) I296N probably damaging Het
Serpinb12 G T 1: 106,884,342 (GRCm39) V363F probably damaging Het
Serpinb9c A G 13: 33,334,016 (GRCm39) I342T probably damaging Het
Shmt2 A G 10: 127,355,945 (GRCm39) V133A probably damaging Het
Slc30a6 A G 17: 74,722,661 (GRCm39) M243V probably benign Het
Slfn2 T A 11: 82,960,487 (GRCm39) N155K probably damaging Het
Spata31h1 A T 10: 82,152,298 (GRCm39) L23M possibly damaging Het
Syne2 A T 12: 75,900,898 (GRCm39) D19V possibly damaging Het
Tcl1b3 A T 12: 105,160,736 (GRCm39) I116L probably benign Het
Tcp11 A G 17: 28,286,766 (GRCm39) I411T probably damaging Het
Tctn1 C T 5: 122,379,859 (GRCm39) A560T probably benign Het
Tenm3 C A 8: 48,682,216 (GRCm39) Q2471H probably damaging Het
Tnr A G 1: 159,713,645 (GRCm39) D691G probably benign Het
Ube3b C T 5: 114,528,451 (GRCm39) P150S probably damaging Het
Ugt2b5 T C 5: 87,287,518 (GRCm39) I216M possibly damaging Het
Unc5d T A 8: 29,156,877 (GRCm39) R789S probably damaging Het
Ush2a G A 1: 188,147,875 (GRCm39) G934D probably damaging Het
Usp6nl A T 2: 6,399,352 (GRCm39) R70S probably damaging Het
Vmn1r181 T C 7: 23,684,309 (GRCm39) I258T possibly damaging Het
Vmn2r15 C A 5: 109,445,302 (GRCm39) D41Y probably damaging Het
Vmn2r17 T A 5: 109,600,691 (GRCm39) I663N probably damaging Het
Vnn3 C A 10: 23,741,780 (GRCm39) Q362K possibly damaging Het
Wdr72 A G 9: 74,059,730 (GRCm39) D380G possibly damaging Het
Wfdc10 G A 2: 164,499,180 (GRCm39) E97K possibly damaging Het
Xdh A T 17: 74,206,007 (GRCm39) C1002* probably null Het
Zscan4e A C 7: 11,041,578 (GRCm39) V126G probably damaging Het
Other mutations in Cwc27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01955:Cwc27 APN 13 104,944,245 (GRCm39) missense probably damaging 1.00
IGL02240:Cwc27 APN 13 104,943,151 (GRCm39) missense probably damaging 0.97
IGL02398:Cwc27 APN 13 104,940,762 (GRCm39) missense possibly damaging 0.82
IGL02620:Cwc27 APN 13 104,938,714 (GRCm39) splice site probably benign
IGL03213:Cwc27 APN 13 104,932,911 (GRCm39) splice site probably benign
pam1 UTSW 13 104,797,865 (GRCm39) nonsense probably null
R0375:Cwc27 UTSW 13 104,944,331 (GRCm39) missense possibly damaging 0.94
R0483:Cwc27 UTSW 13 104,947,724 (GRCm39) critical splice donor site probably null
R0534:Cwc27 UTSW 13 104,768,124 (GRCm39) missense unknown
R0550:Cwc27 UTSW 13 104,941,457 (GRCm39) missense probably damaging 1.00
R0562:Cwc27 UTSW 13 104,797,865 (GRCm39) nonsense probably null
R0563:Cwc27 UTSW 13 104,797,865 (GRCm39) nonsense probably null
R0564:Cwc27 UTSW 13 104,797,865 (GRCm39) nonsense probably null
R0972:Cwc27 UTSW 13 104,797,865 (GRCm39) nonsense probably null
R1536:Cwc27 UTSW 13 104,933,814 (GRCm39) missense probably damaging 1.00
R1546:Cwc27 UTSW 13 104,938,693 (GRCm39) missense probably damaging 1.00
R1587:Cwc27 UTSW 13 104,929,145 (GRCm39) missense probably benign 0.00
R1934:Cwc27 UTSW 13 104,768,184 (GRCm39) missense probably benign 0.28
R2159:Cwc27 UTSW 13 104,940,837 (GRCm39) missense probably damaging 0.98
R2249:Cwc27 UTSW 13 104,768,130 (GRCm39) missense unknown
R2252:Cwc27 UTSW 13 104,768,237 (GRCm39) missense probably damaging 1.00
R2394:Cwc27 UTSW 13 104,932,942 (GRCm39) missense probably benign 0.01
R2698:Cwc27 UTSW 13 104,943,259 (GRCm39) missense probably damaging 0.99
R3899:Cwc27 UTSW 13 104,929,023 (GRCm39) nonsense probably null
R5121:Cwc27 UTSW 13 104,940,861 (GRCm39) missense probably damaging 1.00
R6317:Cwc27 UTSW 13 104,940,769 (GRCm39) nonsense probably null
R6763:Cwc27 UTSW 13 104,947,809 (GRCm39) missense probably damaging 1.00
R7187:Cwc27 UTSW 13 104,797,900 (GRCm39) missense probably benign 0.01
R7958:Cwc27 UTSW 13 104,941,472 (GRCm39) missense probably benign 0.01
R8465:Cwc27 UTSW 13 104,940,776 (GRCm39) missense possibly damaging 0.49
R8466:Cwc27 UTSW 13 104,940,776 (GRCm39) missense possibly damaging 0.49
R8466:Cwc27 UTSW 13 104,940,772 (GRCm39) missense probably benign
R8483:Cwc27 UTSW 13 104,940,776 (GRCm39) missense possibly damaging 0.49
R8483:Cwc27 UTSW 13 104,940,772 (GRCm39) missense probably benign
R8485:Cwc27 UTSW 13 104,940,776 (GRCm39) missense possibly damaging 0.49
R8485:Cwc27 UTSW 13 104,940,772 (GRCm39) missense probably benign
R9320:Cwc27 UTSW 13 104,933,799 (GRCm39) missense probably benign
R9710:Cwc27 UTSW 13 104,943,158 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGAGTTCTCGCCTTCCCAG -3'
(R):5'- AATGTTGTGGGGCACTCAGC -3'

Sequencing Primer
(F):5'- GCCTTCCCAGAGTCTTTATACTAAGG -3'
(R):5'- TGCTGATATTAGAAAACTTCAGGGGC -3'
Posted On 2021-01-18