Incidental Mutation 'R8465:Tcp11'
ID 656803
Institutional Source Beutler Lab
Gene Symbol Tcp11
Ensembl Gene ENSMUSG00000062859
Gene Name t-complex protein 11
Synonyms D17Ken1, Tcp-11
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8465 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 28066747-28080639 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 28067792 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 411 (I411T)
Ref Sequence ENSEMBL: ENSMUSP00000110485 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042692] [ENSMUST00000043925] [ENSMUST00000114836] [ENSMUST00000129046]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000042692
AA Change: I490T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038590
Gene: ENSMUSG00000062859
AA Change: I490T

DomainStartEndE-ValueType
Pfam:Tcp11 126 550 6.2e-102 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000043925
AA Change: I411T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046002
Gene: ENSMUSG00000062859
AA Change: I411T

DomainStartEndE-ValueType
Pfam:Tcp11 44 474 3.3e-129 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114836
AA Change: I411T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110485
Gene: ENSMUSG00000062859
AA Change: I411T

DomainStartEndE-ValueType
Pfam:Tcp11 44 474 3.3e-129 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129046
SMART Domains Protein: ENSMUSP00000116959
Gene: ENSMUSG00000062859

DomainStartEndE-ValueType
Pfam:Tcp11 44 237 2.5e-71 PFAM
Meta Mutation Damage Score 0.4945 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (80/80)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,316,464 L23M possibly damaging Het
Acot6 A T 12: 84,106,441 probably null Het
Adamtsl3 A T 7: 82,598,122 N1429Y probably benign Het
Adk T C 14: 21,103,824 S32P possibly damaging Het
Akap13 A T 7: 75,727,038 M2005L probably benign Het
Atp10a A T 7: 58,828,310 D1367V probably benign Het
Bckdhb A G 9: 83,988,862 I142V probably benign Het
Brap C T 5: 121,679,295 Q322* probably null Het
Carmil3 A T 14: 55,496,848 N401I probably damaging Het
Cdan1 A T 2: 120,728,440 S426T possibly damaging Het
Cdc27 C A 11: 104,517,491 S531I probably benign Het
Cela3a A T 4: 137,403,874 Y184* probably null Het
Cep63 T C 9: 102,613,377 K178R probably benign Het
Cfb G A 17: 34,857,314 Q152* probably null Het
Cnpy2 G A 10: 128,326,175 V106I probably benign Het
Cntn1 GCTGTCTTC GC 15: 92,339,523 probably null Het
Ctc1 G A 11: 69,026,219 G67D probably damaging Het
Cwc27 G T 13: 104,804,264 P196T probably benign Het
Cwc27 C A 13: 104,804,268 L194F possibly damaging Het
Cyp2d12 T G 15: 82,555,177 S11A possibly damaging Het
Ddx55 T A 5: 124,559,121 probably null Het
Dedd2 G T 7: 25,218,906 R75S probably damaging Het
Fat2 G A 11: 55,256,704 S3904F possibly damaging Het
Fibp G A 19: 5,463,187 V177I probably damaging Het
Fsip2 A T 2: 82,979,940 E2201V probably benign Het
Gbp11 C T 5: 105,325,062 D499N probably benign Het
Gfm1 A G 3: 67,431,699 E45G probably damaging Het
Gm884 T A 11: 103,616,121 probably benign Het
H2-D1 A G 17: 35,263,511 Y69C probably damaging Het
Hcar1 A G 5: 123,879,046 F194S probably damaging Het
Heatr4 A T 12: 83,977,933 probably null Het
Kcnd2 G A 6: 21,216,696 C133Y probably damaging Het
Kcnq1 A T 7: 143,425,974 Q619L probably benign Het
Kctd12 T A 14: 102,981,465 R326W probably damaging Het
Kel A G 6: 41,689,538 probably null Het
Lipk A T 19: 34,046,797 I332F probably benign Het
Masp2 A G 4: 148,612,059 D371G possibly damaging Het
Met A G 6: 17,571,810 E1376G probably benign Het
Mup5 A T 4: 61,833,778 I78K probably benign Het
Mynn A T 3: 30,616,641 D526V probably damaging Het
Naip6 G T 13: 100,296,915 T1138N possibly damaging Het
Neurod1 G T 2: 79,454,352 P229Q probably damaging Het
Npepps T G 11: 97,248,259 R162S probably damaging Het
Ntrk3 T A 7: 78,462,883 Q175L probably damaging Het
Obsl1 T C 1: 75,503,388 T310A probably damaging Het
Olfr1062 A T 2: 86,423,631 M15K probably benign Het
Olfr1079 A G 2: 86,538,387 I176T probably damaging Het
Olfr1288 A T 2: 111,479,080 T99S probably benign Het
Olfr25 A T 9: 38,330,114 I176F possibly damaging Het
Pigf G A 17: 86,997,536 T193I possibly damaging Het
Pkp4 T C 2: 59,342,181 V904A possibly damaging Het
Plekha6 C T 1: 133,270,040 T141M probably damaging Het
Rapgef6 G A 11: 54,691,482 D1407N probably benign Het
Rhobtb3 T C 13: 75,939,622 D82G probably damaging Het
Rims1 T C 1: 22,428,480 N767S possibly damaging Het
Ripor2 T A 13: 24,665,468 probably benign Het
Sec14l4 T A 11: 4,043,948 I296N probably damaging Het
Serpinb12 G T 1: 106,956,612 V363F probably damaging Het
Serpinb9c A G 13: 33,150,033 I342T probably damaging Het
Shmt2 A G 10: 127,520,076 V133A probably damaging Het
Slc30a6 A G 17: 74,415,666 M243V probably benign Het
Slfn2 T A 11: 83,069,661 N155K probably damaging Het
Syne2 A T 12: 75,854,124 D19V possibly damaging Het
Tcl1b3 A T 12: 105,194,477 I116L probably benign Het
Tctn1 C T 5: 122,241,796 A560T probably benign Het
Tenm3 C A 8: 48,229,181 Q2471H probably damaging Het
Tnr A G 1: 159,886,075 D691G probably benign Het
Ube3b C T 5: 114,390,390 P150S probably damaging Het
Ugt2b5 T C 5: 87,139,659 I216M possibly damaging Het
Unc5d T A 8: 28,666,849 R789S probably damaging Het
Ush2a G A 1: 188,415,678 G934D probably damaging Het
Usp6nl A T 2: 6,394,541 R70S probably damaging Het
Vmn1r181 T C 7: 23,984,884 I258T possibly damaging Het
Vmn2r15 C A 5: 109,297,436 D41Y probably damaging Het
Vmn2r17 T A 5: 109,452,825 I663N probably damaging Het
Vnn3 C A 10: 23,865,882 Q362K possibly damaging Het
Wdr72 A G 9: 74,152,448 D380G possibly damaging Het
Wfdc10 G A 2: 164,657,260 E97K possibly damaging Het
Xdh A T 17: 73,899,012 C1002* probably null Het
Zscan4e A C 7: 11,307,651 V126G probably damaging Het
Other mutations in Tcp11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02993:Tcp11 APN 17 28070516 missense probably damaging 1.00
IGL03148:Tcp11 APN 17 28070470 missense possibly damaging 0.95
R0487:Tcp11 UTSW 17 28079923 splice site probably null
R0603:Tcp11 UTSW 17 28067810 missense probably damaging 1.00
R0745:Tcp11 UTSW 17 28067160 missense possibly damaging 0.80
R1170:Tcp11 UTSW 17 28071662 missense probably damaging 1.00
R2965:Tcp11 UTSW 17 28069265 missense probably benign 0.38
R5249:Tcp11 UTSW 17 28071783 missense possibly damaging 0.71
R5358:Tcp11 UTSW 17 28078020 missense probably benign 0.05
R5819:Tcp11 UTSW 17 28069236 missense probably damaging 1.00
R6190:Tcp11 UTSW 17 28071717 missense probably benign 0.00
R6657:Tcp11 UTSW 17 28071672 missense probably damaging 1.00
R6698:Tcp11 UTSW 17 28071830 missense possibly damaging 0.63
R7020:Tcp11 UTSW 17 28071705 missense possibly damaging 0.79
R7084:Tcp11 UTSW 17 28067021 missense probably benign 0.43
R8262:Tcp11 UTSW 17 28067027 missense probably damaging 1.00
R8363:Tcp11 UTSW 17 28069247 missense possibly damaging 0.93
R8675:Tcp11 UTSW 17 28069591 missense probably benign 0.00
R8830:Tcp11 UTSW 17 28080230 missense probably benign 0.26
R8831:Tcp11 UTSW 17 28080219 missense probably damaging 0.97
R8940:Tcp11 UTSW 17 28080230 missense probably damaging 0.96
R9689:Tcp11 UTSW 17 28067054 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TAACGGAGCTGGTTTCTTGC -3'
(R):5'- GCCAGCTTACCTGTGTTGTG -3'

Sequencing Primer
(F):5'- GTCACAGAGACTCATGAGAAGTC -3'
(R):5'- TGGTCTAGGCCCGAGGAAG -3'
Posted On 2021-01-18