Incidental Mutation 'R8466:1700017N19Rik'
ID 656839
Institutional Source Beutler Lab
Gene Symbol 1700017N19Rik
Ensembl Gene ENSMUSG00000056912
Gene Name RIKEN cDNA 1700017N19 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock # R8466 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 100590484-100618401 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 100602011 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 94 (E94G)
Ref Sequence ENSEMBL: ENSMUSP00000151731 (fasta)
AlphaFold A0A087WPJ1
Predicted Effect probably benign
Transcript: ENSMUST00000041162
AA Change: E94G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000186825
Predicted Effect probably benign
Transcript: ENSMUST00000187119
AA Change: E94G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000188736
AA Change: E94G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000188930
AA Change: E94G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000190386
AA Change: E94G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000190708
AA Change: E148G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000191336
AA Change: E26G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000218464
AA Change: E94G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd16a G T 17: 35,094,260 R118L probably damaging Het
Adamts1 A G 16: 85,802,512 S67P probably benign Het
Adar C T 3: 89,751,159 P656L probably damaging Het
Afg3l1 G A 8: 123,489,909 D296N probably benign Het
Akap9 G A 5: 4,038,659 R2096Q probably damaging Het
Aldh1a2 T A 9: 71,252,923 I77K probably benign Het
Cacnb4 A C 2: 52,464,667 V233G probably damaging Het
Cage1 T A 13: 38,023,011 Q286L probably damaging Het
Camta1 T A 4: 151,086,120 K1055* probably null Het
Ccdc96 C A 5: 36,484,908 probably benign Het
Cep70 T C 9: 99,278,020 probably null Het
Cwc27 G T 13: 104,804,264 P196T probably benign Het
Cwc27 C A 13: 104,804,268 L194F possibly damaging Het
Ddx24 G T 12: 103,409,901 L779I probably benign Het
Dock7 T C 4: 99,064,099 E378G possibly damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Flnc A G 6: 29,438,622 N172D probably damaging Het
Gm6169 T C 13: 97,098,984 D85G probably damaging Het
Gprin3 C A 6: 59,354,481 Q280H possibly damaging Het
Gprin3 T A 6: 59,354,482 Q280L probably benign Het
Gucy2d C A 7: 98,450,030 P351Q probably damaging Het
H2-M11 G A 17: 36,548,093 G175D probably benign Het
Klhl42 C T 6: 147,107,743 T360M probably benign Het
Lama1 G A 17: 67,813,953 E2695K Het
Lsg1 T C 16: 30,582,101 Q130R probably benign Het
Macf1 T C 4: 123,455,444 T2100A probably benign Het
Muc16 T C 9: 18,643,148 T3950A unknown Het
Myo1c G A 11: 75,658,387 R109H probably damaging Het
Nol4 C A 18: 23,038,581 A8S probably benign Het
Olfr397 A T 11: 73,965,087 T160S probably damaging Het
Olfr404-ps1 A G 11: 74,240,190 I209V probably benign Het
Pabpn1l C T 8: 122,620,886 V216M possibly damaging Het
Papln A C 12: 83,778,481 probably null Het
Pcsk5 A T 19: 17,572,500 C709* probably null Het
Pglyrp3 T A 3: 92,014,634 V3E probably benign Het
Pla2g4f T C 2: 120,300,482 N831D probably damaging Het
Prss22 T C 17: 23,996,828 D40G probably benign Het
Rap1gap2 A G 11: 74,425,231 F208S probably benign Het
Sipa1l2 A T 8: 125,492,246 N117K probably damaging Het
Srsf9 G C 5: 115,327,433 R42P probably benign Het
Stat3 A T 11: 100,895,098 I451N probably damaging Het
Tecrl A T 5: 83,280,520 Y301* probably null Het
Togaram1 T C 12: 64,986,442 S1065P probably benign Het
Usp48 T A 4: 137,623,319 L39Q probably null Het
Utp20 A T 10: 88,818,503 S241T probably damaging Het
Vmn2r50 A G 7: 10,050,070 F159S probably damaging Het
Wdr76 A C 2: 121,510,557 N28H probably damaging Het
Zfhx2 T A 14: 55,072,896 Y731F possibly damaging Het
Zfhx4 A T 3: 5,242,702 E329D probably damaging Het
Zswim8 A T 14: 20,710,676 Q83L possibly damaging Het
Other mutations in 1700017N19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01565:1700017N19Rik APN 10 100603360 missense probably damaging 1.00
IGL02159:1700017N19Rik APN 10 100610665 missense probably damaging 1.00
IGL02556:1700017N19Rik APN 10 100610717 critical splice donor site probably null
IGL02629:1700017N19Rik APN 10 100609144 splice site probably benign
IGL02692:1700017N19Rik APN 10 100603548 missense probably benign 0.05
IGL02962:1700017N19Rik APN 10 100610593 splice site probably null
R0145:1700017N19Rik UTSW 10 100601921 missense probably damaging 0.96
R0402:1700017N19Rik UTSW 10 100609253 missense probably damaging 0.99
R1514:1700017N19Rik UTSW 10 100612867 missense probably damaging 1.00
R1519:1700017N19Rik UTSW 10 100603528 missense probably damaging 0.98
R1680:1700017N19Rik UTSW 10 100603528 missense probably damaging 0.98
R1686:1700017N19Rik UTSW 10 100612860 missense probably damaging 0.97
R3951:1700017N19Rik UTSW 10 100615296 splice site probably benign
R3952:1700017N19Rik UTSW 10 100615296 splice site probably benign
R4423:1700017N19Rik UTSW 10 100605633 missense probably damaging 0.99
R4905:1700017N19Rik UTSW 10 100612818 splice site probably null
R5507:1700017N19Rik UTSW 10 100609233 missense probably benign 0.02
R5898:1700017N19Rik UTSW 10 100612900 missense possibly damaging 0.56
R5898:1700017N19Rik UTSW 10 100615208 missense probably benign 0.20
R5977:1700017N19Rik UTSW 10 100615244 missense probably damaging 0.99
R7034:1700017N19Rik UTSW 10 100609256 critical splice donor site probably null
R7036:1700017N19Rik UTSW 10 100609256 critical splice donor site probably null
R7394:1700017N19Rik UTSW 10 100609176 missense probably benign 0.01
R7412:1700017N19Rik UTSW 10 100612829 nonsense probably null
R7870:1700017N19Rik UTSW 10 100605643 missense probably benign
R7914:1700017N19Rik UTSW 10 100592676 missense probably benign
R8558:1700017N19Rik UTSW 10 100594635 missense probably benign 0.23
R9004:1700017N19Rik UTSW 10 100618335 unclassified probably benign
R9105:1700017N19Rik UTSW 10 100603545 nonsense probably null
Z1088:1700017N19Rik UTSW 10 100605639 missense probably damaging 1.00
Z1176:1700017N19Rik UTSW 10 100612429 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGACTAAAGTGTTGGGTTTTCTC -3'
(R):5'- TGCCAGTGTCAGAGTAGTTGTC -3'

Sequencing Primer
(F):5'- TCTGTAGATACCACCTTACAGAAAG -3'
(R):5'- GTACCTCTTTGTAAGTACGGGCAC -3'
Posted On 2021-01-18