Incidental Mutation 'R8467:C4b'
ID 656892
Institutional Source Beutler Lab
Gene Symbol C4b
Ensembl Gene ENSMUSG00000073418
Gene Name complement C4B (Chido blood group)
Synonyms Ss, C4
MMRRC Submission 067911-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8467 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 34947354-34962856 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34951787 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1326 (T1326A)
Ref Sequence ENSEMBL: ENSMUSP00000069418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069507]
AlphaFold P01029
Predicted Effect possibly damaging
Transcript: ENSMUST00000069507
AA Change: T1326A

PolyPhen 2 Score 0.510 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000069418
Gene: ENSMUSG00000073418
AA Change: T1326A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:A2M_N 138 231 2e-19 PFAM
A2M_N_2 470 609 2.87e-26 SMART
ANATO 700 734 3.58e-12 SMART
low complexity region 761 771 N/A INTRINSIC
A2M 779 867 1.46e-27 SMART
Pfam:Thiol-ester_cl 995 1024 7.7e-13 PFAM
Pfam:A2M_comp 1047 1313 1.3e-82 PFAM
low complexity region 1441 1447 N/A INTRINSIC
A2M_recep 1475 1564 1.03e-36 SMART
C345C 1608 1720 5.69e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173057
SMART Domains Protein: ENSMUSP00000134611
Gene: ENSMUSG00000073418

DomainStartEndE-ValueType
Pfam:A2M 1 62 6.5e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (38/38)
MGI Phenotype PHENOTYPE: Homozygous C4 deficient mice have compromised immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apon G A 10: 128,091,002 (GRCm39) V227I probably benign Het
Arl9 T C 5: 77,154,446 (GRCm39) I58T probably damaging Het
Cd55b A C 1: 130,347,501 (GRCm39) S103R possibly damaging Het
Cep350 A G 1: 155,791,321 (GRCm39) F1268L probably benign Het
D17H6S53E T A 17: 35,346,246 (GRCm39) D52E probably damaging Het
Dhx57 G C 17: 80,561,853 (GRCm39) P887R probably damaging Het
Ehd1 T G 19: 6,331,318 (GRCm39) S159A probably benign Het
Fam98a C A 17: 75,851,830 (GRCm39) G84W probably damaging Het
Fbxl22 C T 9: 66,421,849 (GRCm39) probably null Het
Gbp11 T A 5: 105,475,457 (GRCm39) Y297F probably damaging Het
Gimap8 A G 6: 48,627,269 (GRCm39) H81R probably benign Het
Gpd2 A G 2: 57,254,596 (GRCm39) E680G possibly damaging Het
Grid2 A G 6: 64,510,635 (GRCm39) D755G probably benign Het
Hivep3 T C 4: 119,952,238 (GRCm39) Y185H probably damaging Het
Hunk A G 16: 90,293,508 (GRCm39) R597G probably damaging Het
Igfbp3 A G 11: 7,163,523 (GRCm39) C90R probably damaging Het
Il7r T C 15: 9,512,973 (GRCm39) T179A probably benign Het
Iqsec3 G A 6: 121,358,676 (GRCm39) T1003I probably benign Het
Kif13b A T 14: 64,996,154 (GRCm39) D980V probably damaging Het
Kif21b A G 1: 136,100,021 (GRCm39) D1525G probably damaging Het
Lgsn A G 1: 31,242,731 (GRCm39) E271G probably benign Het
Lrp1 G A 10: 127,394,519 (GRCm39) R2565C probably damaging Het
Marchf10 A T 11: 105,280,979 (GRCm39) Y435* probably null Het
Msantd5 A G 11: 51,125,105 (GRCm39) I108V possibly damaging Het
Mup9 C T 4: 60,376,481 (GRCm39) probably null Het
Myo6 T A 9: 80,136,168 (GRCm39) V97E probably damaging Het
Nobox G T 6: 43,282,479 (GRCm39) D309E probably benign Het
Nup155 A G 15: 8,151,015 (GRCm39) D355G probably benign Het
Or6n1 A T 1: 173,917,007 (GRCm39) T134S probably benign Het
Otud7b A G 3: 96,062,993 (GRCm39) D744G probably benign Het
Phgdh A G 3: 98,228,627 (GRCm39) V182A probably benign Het
Scarb1 A T 5: 125,375,731 (GRCm39) I231N probably damaging Het
Scn9a A G 2: 66,332,015 (GRCm39) L1276P probably damaging Het
Smarca2 T A 19: 26,597,121 (GRCm39) M1K probably null Het
Sp3 G A 2: 72,801,482 (GRCm39) T177I possibly damaging Het
Vmn1r21 A T 6: 57,821,441 (GRCm39) M1K probably null Het
Zfyve16 A T 13: 92,644,790 (GRCm39) H1137Q probably damaging Het
Other mutations in C4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:C4b APN 17 34,953,402 (GRCm39) missense probably damaging 1.00
IGL00433:C4b APN 17 34,961,015 (GRCm39) missense possibly damaging 0.75
IGL00471:C4b APN 17 34,953,403 (GRCm39) missense probably damaging 1.00
IGL00515:C4b APN 17 34,947,865 (GRCm39) missense probably damaging 1.00
IGL01599:C4b APN 17 34,961,993 (GRCm39) splice site probably benign
IGL01761:C4b APN 17 34,958,912 (GRCm39) missense possibly damaging 0.56
IGL02004:C4b APN 17 34,957,984 (GRCm39) unclassified probably benign
IGL02215:C4b APN 17 34,953,465 (GRCm39) missense probably damaging 1.00
IGL02517:C4b APN 17 34,953,382 (GRCm39) missense probably benign 0.01
IGL02926:C4b APN 17 34,949,686 (GRCm39) missense possibly damaging 0.95
IGL03031:C4b APN 17 34,950,104 (GRCm39) missense possibly damaging 0.47
IGL03057:C4b APN 17 34,956,738 (GRCm39) unclassified probably benign
IGL03165:C4b APN 17 34,958,929 (GRCm39) missense probably benign 0.13
IGL03380:C4b APN 17 34,959,260 (GRCm39) missense probably benign 0.01
Aspiration UTSW 17 34,953,416 (GRCm39) missense probably benign 0.00
Inspiration UTSW 17 34,951,140 (GRCm39) splice site probably null
Peroration UTSW 17 34,948,373 (GRCm39) critical splice donor site probably null
perspiration UTSW 17 34,948,805 (GRCm39) missense probably damaging 1.00
FR4548:C4b UTSW 17 34,959,971 (GRCm39) missense probably benign 0.00
PIT4142001:C4b UTSW 17 34,952,675 (GRCm39) missense probably benign 0.01
R0064:C4b UTSW 17 34,957,830 (GRCm39) missense probably damaging 1.00
R0113:C4b UTSW 17 34,960,214 (GRCm39) missense probably damaging 0.98
R0143:C4b UTSW 17 34,953,193 (GRCm39) unclassified probably benign
R0254:C4b UTSW 17 34,953,750 (GRCm39) missense probably benign 0.00
R0320:C4b UTSW 17 34,952,135 (GRCm39) missense probably benign 0.01
R0391:C4b UTSW 17 34,954,588 (GRCm39) splice site probably benign
R0399:C4b UTSW 17 34,947,843 (GRCm39) missense probably damaging 1.00
R0467:C4b UTSW 17 34,955,101 (GRCm39) missense probably benign 0.01
R0549:C4b UTSW 17 34,954,389 (GRCm39) missense probably damaging 1.00
R0561:C4b UTSW 17 34,953,391 (GRCm39) missense probably damaging 0.99
R0662:C4b UTSW 17 34,949,862 (GRCm39) missense probably damaging 1.00
R0941:C4b UTSW 17 34,959,029 (GRCm39) missense probably benign
R1161:C4b UTSW 17 34,948,567 (GRCm39) missense probably damaging 1.00
R1169:C4b UTSW 17 34,961,946 (GRCm39) missense probably benign 0.14
R1186:C4b UTSW 17 34,955,283 (GRCm39) missense possibly damaging 0.47
R1310:C4b UTSW 17 34,948,567 (GRCm39) missense probably damaging 1.00
R1398:C4b UTSW 17 34,949,693 (GRCm39) unclassified probably benign
R1472:C4b UTSW 17 34,962,743 (GRCm39) nonsense probably null
R1496:C4b UTSW 17 34,958,995 (GRCm39) missense probably benign 0.30
R1544:C4b UTSW 17 34,957,941 (GRCm39) missense probably benign 0.13
R1588:C4b UTSW 17 34,959,999 (GRCm39) missense probably benign
R1645:C4b UTSW 17 34,959,571 (GRCm39) missense probably damaging 1.00
R1664:C4b UTSW 17 34,951,952 (GRCm39) missense probably damaging 1.00
R1678:C4b UTSW 17 34,962,624 (GRCm39) missense probably benign 0.05
R1710:C4b UTSW 17 34,962,638 (GRCm39) splice site probably benign
R1713:C4b UTSW 17 34,948,245 (GRCm39) splice site probably benign
R1770:C4b UTSW 17 34,955,901 (GRCm39) missense possibly damaging 0.78
R1859:C4b UTSW 17 34,954,527 (GRCm39) missense probably benign
R1924:C4b UTSW 17 34,948,631 (GRCm39) missense probably damaging 1.00
R2057:C4b UTSW 17 34,947,594 (GRCm39) missense probably damaging 1.00
R2060:C4b UTSW 17 34,955,075 (GRCm39) missense probably damaging 1.00
R2184:C4b UTSW 17 34,956,676 (GRCm39) missense probably benign 0.27
R2306:C4b UTSW 17 34,947,492 (GRCm39) missense probably benign 0.00
R2363:C4b UTSW 17 34,955,032 (GRCm39) splice site probably benign
R2365:C4b UTSW 17 34,955,032 (GRCm39) splice site probably benign
R2379:C4b UTSW 17 34,954,717 (GRCm39) missense possibly damaging 0.81
R2860:C4b UTSW 17 34,953,732 (GRCm39) missense probably damaging 0.99
R2861:C4b UTSW 17 34,953,732 (GRCm39) missense probably damaging 0.99
R3551:C4b UTSW 17 34,960,846 (GRCm39) missense possibly damaging 0.75
R3765:C4b UTSW 17 34,948,814 (GRCm39) missense probably damaging 0.98
R4157:C4b UTSW 17 34,961,829 (GRCm39) missense probably damaging 1.00
R4299:C4b UTSW 17 34,950,118 (GRCm39) missense possibly damaging 0.52
R4365:C4b UTSW 17 34,953,717 (GRCm39) missense possibly damaging 0.65
R4411:C4b UTSW 17 34,947,838 (GRCm39) missense probably damaging 1.00
R4613:C4b UTSW 17 34,953,525 (GRCm39) missense probably benign 0.12
R4784:C4b UTSW 17 34,952,380 (GRCm39) missense probably benign 0.00
R4790:C4b UTSW 17 34,953,117 (GRCm39) missense probably benign 0.01
R4831:C4b UTSW 17 34,955,864 (GRCm39) splice site probably null
R4879:C4b UTSW 17 34,962,621 (GRCm39) missense probably damaging 0.99
R5036:C4b UTSW 17 34,959,419 (GRCm39) critical splice acceptor site probably null
R5361:C4b UTSW 17 34,960,212 (GRCm39) missense probably benign 0.15
R5384:C4b UTSW 17 34,956,635 (GRCm39) missense possibly damaging 0.89
R5518:C4b UTSW 17 34,953,416 (GRCm39) missense probably benign 0.00
R5590:C4b UTSW 17 34,959,309 (GRCm39) missense probably damaging 0.98
R5643:C4b UTSW 17 34,961,391 (GRCm39) missense probably benign 0.01
R5644:C4b UTSW 17 34,961,391 (GRCm39) missense probably benign 0.01
R5833:C4b UTSW 17 34,949,647 (GRCm39) missense probably damaging 1.00
R5931:C4b UTSW 17 34,948,167 (GRCm39) missense probably damaging 0.99
R6178:C4b UTSW 17 34,952,380 (GRCm39) missense probably benign 0.00
R6209:C4b UTSW 17 34,960,061 (GRCm39) missense possibly damaging 0.93
R6225:C4b UTSW 17 34,957,848 (GRCm39) missense possibly damaging 0.64
R6518:C4b UTSW 17 34,953,179 (GRCm39) missense probably damaging 0.98
R6613:C4b UTSW 17 34,952,539 (GRCm39) missense probably damaging 0.99
R6781:C4b UTSW 17 34,961,928 (GRCm39) missense probably damaging 0.99
R6807:C4b UTSW 17 34,949,930 (GRCm39) missense probably benign 0.17
R6858:C4b UTSW 17 34,948,805 (GRCm39) missense probably damaging 1.00
R6962:C4b UTSW 17 34,951,140 (GRCm39) splice site probably null
R7068:C4b UTSW 17 34,952,451 (GRCm39) missense probably damaging 1.00
R7081:C4b UTSW 17 34,954,417 (GRCm39) missense probably benign 0.27
R7105:C4b UTSW 17 34,949,885 (GRCm39) missense possibly damaging 0.52
R7211:C4b UTSW 17 34,954,508 (GRCm39) missense possibly damaging 0.92
R7296:C4b UTSW 17 34,962,633 (GRCm39) missense probably damaging 1.00
R7314:C4b UTSW 17 34,959,330 (GRCm39) missense probably benign
R7330:C4b UTSW 17 34,949,446 (GRCm39) missense probably damaging 1.00
R7397:C4b UTSW 17 34,961,364 (GRCm39) missense possibly damaging 0.80
R7437:C4b UTSW 17 34,953,707 (GRCm39) missense probably benign 0.10
R7490:C4b UTSW 17 34,950,054 (GRCm39) nonsense probably null
R7597:C4b UTSW 17 34,958,649 (GRCm39) missense probably benign
R7633:C4b UTSW 17 34,948,373 (GRCm39) critical splice donor site probably null
R7900:C4b UTSW 17 34,958,751 (GRCm39) missense probably benign 0.03
R7910:C4b UTSW 17 34,959,326 (GRCm39) missense probably benign 0.00
R7923:C4b UTSW 17 34,961,354 (GRCm39) missense probably damaging 1.00
R7960:C4b UTSW 17 34,960,252 (GRCm39) splice site probably null
R8420:C4b UTSW 17 34,953,513 (GRCm39) missense probably damaging 0.97
R8558:C4b UTSW 17 34,955,541 (GRCm39) missense probably damaging 1.00
R8725:C4b UTSW 17 34,953,459 (GRCm39) missense probably damaging 1.00
R8727:C4b UTSW 17 34,953,459 (GRCm39) missense probably damaging 1.00
R8853:C4b UTSW 17 34,948,879 (GRCm39) missense possibly damaging 0.91
R8934:C4b UTSW 17 34,951,958 (GRCm39) missense possibly damaging 0.78
R8944:C4b UTSW 17 34,961,913 (GRCm39) missense probably benign 0.00
R8960:C4b UTSW 17 34,952,892 (GRCm39) missense probably damaging 1.00
R8982:C4b UTSW 17 34,953,338 (GRCm39) critical splice donor site probably null
R9104:C4b UTSW 17 34,948,233 (GRCm39) missense probably benign 0.39
R9114:C4b UTSW 17 34,948,404 (GRCm39) missense probably damaging 0.99
R9348:C4b UTSW 17 34,952,159 (GRCm39) missense probably benign 0.01
R9428:C4b UTSW 17 34,949,885 (GRCm39) missense possibly damaging 0.52
R9533:C4b UTSW 17 34,956,698 (GRCm39) nonsense probably null
R9591:C4b UTSW 17 34,957,929 (GRCm39) missense probably benign 0.00
R9678:C4b UTSW 17 34,960,763 (GRCm39) critical splice donor site probably null
Z1176:C4b UTSW 17 34,950,121 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGGTTTGACCACACAGCCAG -3'
(R):5'- ATTCCGCAGTACCCAGGTAG -3'

Sequencing Primer
(F):5'- GCCAGAAGAAAGTCAGTCTCC -3'
(R):5'- CAGGTAGGGGCAGCCACAG -3'
Posted On 2021-01-18