Incidental Mutation 'R8467:Ehd1'
ID 656896
Institutional Source Beutler Lab
Gene Symbol Ehd1
Ensembl Gene ENSMUSG00000024772
Gene Name EH-domain containing 1
Synonyms RME-1, Past1
MMRRC Submission 067911-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8467 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 6326926-6350126 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 6331318 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 159 (S159A)
Ref Sequence ENSEMBL: ENSMUSP00000025684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025684]
AlphaFold Q9WVK4
Predicted Effect probably benign
Transcript: ENSMUST00000025684
AA Change: S159A

PolyPhen 2 Score 0.237 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000025684
Gene: ENSMUSG00000024772
AA Change: S159A

DomainStartEndE-ValueType
Pfam:EHD_N 24 56 1.2e-19 PFAM
Pfam:MMR_HSR1 60 220 5.1e-9 PFAM
Pfam:Dynamin_N 61 221 6.6e-15 PFAM
low complexity region 420 433 N/A INTRINSIC
EH 438 531 1.82e-45 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a highly conserved gene family encoding EPS15 homology (EH) domain-containing proteins. The protein-binding EH domain was first noted in EPS15, a substrate for the epidermal growth factor receptor. The EH domain has been shown to be an important motif in proteins involved in protein-protein interactions and in intracellular sorting. The protein encoded by this gene is thought to play a role in the endocytosis of IGF1 receptors. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-out allele show perinatal and postnatal lethality, decreased body weight, and male infertility due to defective spermatogenesis; female homozygotes may display malocclusion and variable ocular defects, including congenital central cataracts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apon G A 10: 128,091,002 (GRCm39) V227I probably benign Het
Arl9 T C 5: 77,154,446 (GRCm39) I58T probably damaging Het
C4b T C 17: 34,951,787 (GRCm39) T1326A possibly damaging Het
Cd55b A C 1: 130,347,501 (GRCm39) S103R possibly damaging Het
Cep350 A G 1: 155,791,321 (GRCm39) F1268L probably benign Het
D17H6S53E T A 17: 35,346,246 (GRCm39) D52E probably damaging Het
Dhx57 G C 17: 80,561,853 (GRCm39) P887R probably damaging Het
Fam98a C A 17: 75,851,830 (GRCm39) G84W probably damaging Het
Fbxl22 C T 9: 66,421,849 (GRCm39) probably null Het
Gbp11 T A 5: 105,475,457 (GRCm39) Y297F probably damaging Het
Gimap8 A G 6: 48,627,269 (GRCm39) H81R probably benign Het
Gpd2 A G 2: 57,254,596 (GRCm39) E680G possibly damaging Het
Grid2 A G 6: 64,510,635 (GRCm39) D755G probably benign Het
Hivep3 T C 4: 119,952,238 (GRCm39) Y185H probably damaging Het
Hunk A G 16: 90,293,508 (GRCm39) R597G probably damaging Het
Igfbp3 A G 11: 7,163,523 (GRCm39) C90R probably damaging Het
Il7r T C 15: 9,512,973 (GRCm39) T179A probably benign Het
Iqsec3 G A 6: 121,358,676 (GRCm39) T1003I probably benign Het
Kif13b A T 14: 64,996,154 (GRCm39) D980V probably damaging Het
Kif21b A G 1: 136,100,021 (GRCm39) D1525G probably damaging Het
Lgsn A G 1: 31,242,731 (GRCm39) E271G probably benign Het
Lrp1 G A 10: 127,394,519 (GRCm39) R2565C probably damaging Het
Marchf10 A T 11: 105,280,979 (GRCm39) Y435* probably null Het
Msantd5 A G 11: 51,125,105 (GRCm39) I108V possibly damaging Het
Mup9 C T 4: 60,376,481 (GRCm39) probably null Het
Myo6 T A 9: 80,136,168 (GRCm39) V97E probably damaging Het
Nobox G T 6: 43,282,479 (GRCm39) D309E probably benign Het
Nup155 A G 15: 8,151,015 (GRCm39) D355G probably benign Het
Or6n1 A T 1: 173,917,007 (GRCm39) T134S probably benign Het
Otud7b A G 3: 96,062,993 (GRCm39) D744G probably benign Het
Phgdh A G 3: 98,228,627 (GRCm39) V182A probably benign Het
Scarb1 A T 5: 125,375,731 (GRCm39) I231N probably damaging Het
Scn9a A G 2: 66,332,015 (GRCm39) L1276P probably damaging Het
Smarca2 T A 19: 26,597,121 (GRCm39) M1K probably null Het
Sp3 G A 2: 72,801,482 (GRCm39) T177I possibly damaging Het
Vmn1r21 A T 6: 57,821,441 (GRCm39) M1K probably null Het
Zfyve16 A T 13: 92,644,790 (GRCm39) H1137Q probably damaging Het
Other mutations in Ehd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Ehd1 APN 19 6,348,177 (GRCm39) missense possibly damaging 0.86
IGL02573:Ehd1 APN 19 6,344,330 (GRCm39) missense probably damaging 1.00
IGL03146:Ehd1 APN 19 6,327,368 (GRCm39) missense probably damaging 1.00
declining UTSW 19 6,344,418 (GRCm39) missense probably damaging 1.00
R1376:Ehd1 UTSW 19 6,344,418 (GRCm39) missense probably damaging 1.00
R1376:Ehd1 UTSW 19 6,344,418 (GRCm39) missense probably damaging 1.00
R1593:Ehd1 UTSW 19 6,348,330 (GRCm39) missense
R2062:Ehd1 UTSW 19 6,348,108 (GRCm39) missense probably benign 0.11
R2064:Ehd1 UTSW 19 6,348,108 (GRCm39) missense probably benign 0.11
R2065:Ehd1 UTSW 19 6,348,108 (GRCm39) missense probably benign 0.11
R2066:Ehd1 UTSW 19 6,348,108 (GRCm39) missense probably benign 0.11
R2067:Ehd1 UTSW 19 6,348,108 (GRCm39) missense probably benign 0.11
R2068:Ehd1 UTSW 19 6,348,108 (GRCm39) missense probably benign 0.11
R2217:Ehd1 UTSW 19 6,348,502 (GRCm39) missense probably damaging 1.00
R3436:Ehd1 UTSW 19 6,327,044 (GRCm39) nonsense probably null
R3705:Ehd1 UTSW 19 6,348,330 (GRCm39) missense
R4654:Ehd1 UTSW 19 6,326,994 (GRCm39) utr 5 prime probably benign
R4902:Ehd1 UTSW 19 6,344,273 (GRCm39) missense possibly damaging 0.91
R5001:Ehd1 UTSW 19 6,347,724 (GRCm39) missense probably benign 0.14
R5076:Ehd1 UTSW 19 6,327,251 (GRCm39) missense probably benign 0.02
R6327:Ehd1 UTSW 19 6,348,375 (GRCm39) missense possibly damaging 0.81
R6679:Ehd1 UTSW 19 6,344,474 (GRCm39) missense probably benign 0.01
R7120:Ehd1 UTSW 19 6,347,591 (GRCm39) missense probably benign 0.00
R7183:Ehd1 UTSW 19 6,347,684 (GRCm39) missense probably benign 0.02
R7215:Ehd1 UTSW 19 6,347,672 (GRCm39) missense possibly damaging 0.81
R7853:Ehd1 UTSW 19 6,327,225 (GRCm39) missense probably damaging 0.99
R8523:Ehd1 UTSW 19 6,344,613 (GRCm39) missense probably damaging 0.98
R8879:Ehd1 UTSW 19 6,348,354 (GRCm39) missense probably damaging 0.97
R8957:Ehd1 UTSW 19 6,344,439 (GRCm39) missense probably damaging 1.00
R9011:Ehd1 UTSW 19 6,348,108 (GRCm39) missense probably benign 0.11
R9664:Ehd1 UTSW 19 6,331,262 (GRCm39) missense probably benign 0.01
R9687:Ehd1 UTSW 19 6,348,330 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- ATTCCAGTTCATTTGTCCAGAGGG -3'
(R):5'- AAGCACCTGTGATCTTAGCTGG -3'

Sequencing Primer
(F):5'- CAGTTCATTTGTCCAGAGGGAGGAG -3'
(R):5'- GGACTATTCCGGTCACCTGAC -3'
Posted On 2021-01-18