Incidental Mutation 'R8468:Fastkd2'
ID 656898
Institutional Source Beutler Lab
Gene Symbol Fastkd2
Ensembl Gene ENSMUSG00000025962
Gene Name FAST kinase domains 2
Synonyms 2810421I24Rik
MMRRC Submission 067912-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8468 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 63769758-63792544 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 63770923 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 93 (L93Q)
Ref Sequence ENSEMBL: ENSMUSP00000027103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027103] [ENSMUST00000114094]
AlphaFold Q922E6
Predicted Effect probably benign
Transcript: ENSMUST00000027103
AA Change: L93Q

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000027103
Gene: ENSMUSG00000025962
AA Change: L93Q

DomainStartEndE-ValueType
low complexity region 310 323 N/A INTRINSIC
Pfam:FAST_1 443 512 2.3e-23 PFAM
low complexity region 546 557 N/A INTRINSIC
RAP 619 675 1.66e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114094
SMART Domains Protein: ENSMUSP00000109728
Gene: ENSMUSG00000025963

DomainStartEndE-ValueType
low complexity region 69 81 N/A INTRINSIC
SCOP:d1b8pa1 131 282 1e-16 SMART
PDB:5MDH|B 131 457 3e-32 PDB
SCOP:d7mdha2 290 454 7e-18 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is localized in the mitochondrial inner compartment and that may play a role in mitochondrial apoptosis. Nonsense mutations have been reported to result in cytochrome c oxidase deficiency. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 A G 16: 85,592,444 (GRCm39) W655R possibly damaging Het
Adamts3 C T 5: 89,842,627 (GRCm39) A748T probably benign Het
Ano1 A C 7: 144,209,357 (GRCm39) F248C probably damaging Het
Ap2b1 T A 11: 83,241,891 (GRCm39) L628Q probably damaging Het
BC035947 C A 1: 78,474,967 (GRCm39) A522S probably damaging Het
Bdp1 A G 13: 100,197,076 (GRCm39) V1103A probably benign Het
Cd248 T A 19: 5,119,910 (GRCm39) I586N possibly damaging Het
Dnah9 C A 11: 65,722,556 (GRCm39) M4428I probably benign Het
Epha5 T C 5: 84,290,275 (GRCm39) probably null Het
Fan1 T A 7: 64,022,234 (GRCm39) N340Y probably damaging Het
Gm6665 T C 18: 31,953,453 (GRCm39) D5G possibly damaging Het
Gphn T C 12: 78,273,601 (GRCm39) V17A probably benign Het
Gpr85 A T 6: 13,836,295 (GRCm39) L203H probably damaging Het
Grk6 A G 13: 55,599,198 (GRCm39) Y166C probably damaging Het
Ints3 A G 3: 90,313,560 (GRCm39) V356A probably damaging Het
Krt33b G A 11: 99,920,615 (GRCm39) R13C probably damaging Het
Lgals3 A G 14: 47,619,104 (GRCm39) I146V possibly damaging Het
Lrp1 G A 10: 127,394,519 (GRCm39) R2565C probably damaging Het
Miip G T 4: 147,945,928 (GRCm39) D325E probably damaging Het
Naaladl1 T A 19: 6,158,615 (GRCm39) V249E probably damaging Het
Nfxl1 C T 5: 72,675,548 (GRCm39) R811K possibly damaging Het
Or12e10 T C 2: 87,641,082 (GRCm39) I306T possibly damaging Het
Or2ag2b A G 7: 106,418,046 (GRCm39) Y252C possibly damaging Het
Or52e7 A T 7: 104,684,953 (GRCm39) I183F probably damaging Het
Or56a3b A G 7: 104,770,685 (GRCm39) D7G probably benign Het
Or5ak24 T A 2: 85,260,522 (GRCm39) Y217F probably damaging Het
Or6c69c C T 10: 129,910,303 (GRCm39) T8I probably benign Het
Pkd2l2 A G 18: 34,560,464 (GRCm39) D357G possibly damaging Het
Ppp1r36 A G 12: 76,482,979 (GRCm39) Y189C probably damaging Het
Rev3l A G 10: 39,703,987 (GRCm39) E2011G probably damaging Het
Sestd1 T A 2: 77,022,090 (GRCm39) T534S probably benign Het
Sfmbt1 G A 14: 30,495,941 (GRCm39) A75T probably benign Het
Smarcc2 G A 10: 128,320,262 (GRCm39) R882H probably benign Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,453,579 (GRCm39) probably benign Het
Speg C T 1: 75,407,953 (GRCm39) A3216V probably damaging Het
Vmn1r12 A G 6: 57,136,370 (GRCm39) T112A probably benign Het
Zfp937 T G 2: 150,080,634 (GRCm39) D221E probably benign Het
Other mutations in Fastkd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Fastkd2 APN 1 63,776,930 (GRCm39) splice site probably benign
IGL01890:Fastkd2 APN 1 63,771,320 (GRCm39) missense probably benign 0.06
IGL02698:Fastkd2 APN 1 63,787,158 (GRCm39) missense probably benign 0.01
IGL02992:Fastkd2 APN 1 63,777,083 (GRCm39) splice site probably benign
IGL03208:Fastkd2 APN 1 63,778,365 (GRCm39) missense probably damaging 1.00
R0172:Fastkd2 UTSW 1 63,771,187 (GRCm39) missense possibly damaging 0.78
R0304:Fastkd2 UTSW 1 63,791,559 (GRCm39) missense possibly damaging 0.46
R0385:Fastkd2 UTSW 1 63,776,970 (GRCm39) missense probably benign 0.01
R0486:Fastkd2 UTSW 1 63,791,499 (GRCm39) missense possibly damaging 0.61
R1115:Fastkd2 UTSW 1 63,787,114 (GRCm39) splice site probably benign
R1468:Fastkd2 UTSW 1 63,771,385 (GRCm39) unclassified probably benign
R1579:Fastkd2 UTSW 1 63,785,046 (GRCm39) missense probably null 0.00
R1729:Fastkd2 UTSW 1 63,790,459 (GRCm39) nonsense probably null
R3937:Fastkd2 UTSW 1 63,776,995 (GRCm39) missense possibly damaging 0.48
R4326:Fastkd2 UTSW 1 63,791,516 (GRCm39) missense probably benign 0.07
R4327:Fastkd2 UTSW 1 63,791,516 (GRCm39) missense probably benign 0.07
R4463:Fastkd2 UTSW 1 63,774,968 (GRCm39) intron probably benign
R4473:Fastkd2 UTSW 1 63,770,833 (GRCm39) missense probably damaging 0.97
R4760:Fastkd2 UTSW 1 63,785,045 (GRCm39) missense probably benign 0.00
R5012:Fastkd2 UTSW 1 63,789,055 (GRCm39) intron probably benign
R5176:Fastkd2 UTSW 1 63,770,598 (GRCm39) unclassified probably benign
R5478:Fastkd2 UTSW 1 63,778,345 (GRCm39) missense probably benign 0.13
R5619:Fastkd2 UTSW 1 63,778,469 (GRCm39) missense probably benign 0.25
R6893:Fastkd2 UTSW 1 63,770,953 (GRCm39) missense possibly damaging 0.75
R7038:Fastkd2 UTSW 1 63,771,032 (GRCm39) missense possibly damaging 0.79
R7049:Fastkd2 UTSW 1 63,771,009 (GRCm39) missense probably benign 0.04
R7510:Fastkd2 UTSW 1 63,776,948 (GRCm39) missense possibly damaging 0.83
R7810:Fastkd2 UTSW 1 63,770,851 (GRCm39) missense possibly damaging 0.61
R7889:Fastkd2 UTSW 1 63,774,619 (GRCm39) splice site probably null
R8263:Fastkd2 UTSW 1 63,770,968 (GRCm39) missense probably benign 0.03
R8271:Fastkd2 UTSW 1 63,787,183 (GRCm39) missense probably benign 0.26
R8321:Fastkd2 UTSW 1 63,787,138 (GRCm39) missense probably benign 0.00
R8767:Fastkd2 UTSW 1 63,775,080 (GRCm39) missense probably benign 0.00
Z1177:Fastkd2 UTSW 1 63,773,996 (GRCm39) critical splice donor site probably null
Z1177:Fastkd2 UTSW 1 63,773,995 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATTGGGAACTTGCAGACCAG -3'
(R):5'- GTGCTTTTGAAAATGTGTCCAGC -3'

Sequencing Primer
(F):5'- GAACTTGCAGACCAGAGGTTATTC -3'
(R):5'- ACTCAGAGAGTTACACTCCTGGG -3'
Posted On 2021-01-18